NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Structural Biology Knowledgebase: 1QWB SBKB.org

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 17
  • Conformers Submitted: 17
  • Selection Criteria: All Calculated Structures Submitted Structures with Acceptable Covalent Geometry Structures with Favorable Non Bond Energy Structures with the Least Restraint Violations Structures with the Lowest Energy


Sequence Display for 1QWB

Classification: RNA

Total Structure Weight: 8366.12

Macromolecule Entities
Molecule Chains Length Organism Details
sNRE26 A 26 synthetic RNA contains the consensus sequence for the in vitro selected NRE.

Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 17
  • Conformers Submitted: 17
  • Selection Criteria: all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint violations,structures with the lowest energy

Structure Validation

View Full Validation Report

Entry History

Deposition Data

  • Deposited Date: 2003-09-01
  • Released Date: 2003-11-25
  • Deposition author(s): Finger, L.D., Trantirek, L., Johansson, C., Feigon, J.

Revision History

  • 2011-07-13
    Type: Version format compliance | Details: compliance with PDB Exchange Dictionary V4