1FG0

LARGE RIBOSOMAL SUBUNIT COMPLEXED WITH A 13 BP MINIHELIX-PUROMYCIN COMPOUND

Structural Biology Knowledgebase: 1FG0 SBKB.org


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 3.0 Å
  • R-Value Work:

Literature

Macromolecules
Sequence Display for 1FG0

Classification: ribosome

Total Structure Weight: 205991.83

Macromolecule Entities
Molecule Chains Length Organism Details
23S RIBOSOMAL RNA A 602 Haloarcula marismortui PART OF THE 50S LARGE RIBOSOMAL SUBUNIT
5'-R(CCGGCGGGCUGGUUCAAACCGGCCCGCCGGACC)-3'-5'-R(P-PUROMYCIN)-3' B 34 synthetic THIS 13 BP MINIHELIX MIMICS A TYROSYL-TRNA ACCEPTOR STEM

Small Molecules
Modified Residues 1 Unique
ID Chains Type Formula 2D Diagram Parent
PPU
Query on PPU
B RNA LINKING C22 H30 N7 O8 P A

Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 3.0 Å
  • R-Value Observed:
  • Space Group: C 2 2 21

Unit Cell:

Length (Å) Angle (°)
a = 212.00 α = 90.00
b = 300.00 β = 90.00
c = 574.00 γ = 90.00

Structure Validation

View Full Validation Report



Entry History

Deposition Data

  • Deposited Date: 2000-07-26
  • Released Date: 2000-08-28
  • Deposition author(s): Nissen, P., Hansen, J., Ban, N., Moore, P.B., Steitz, T.A.

Revision History

  • 2011-07-13
    Type: Version format compliance | Details: compliance with PDB Exchange Dictionary V4