1QWA

NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

SOLUTION NMR

NMR Experiment
Experiment	Type	Sample Contents	Solvent	Ionic Strength	pH	Pressure	Temperature (K)	Spectrometer
1	2D NOESY	1-1.5mM B2 NA, in 5mM potassium phosphate buffer, 50uM EDTA, 0.02% NaN3 95% H2O, 5% D2O	95% H2O/5% D2O	5mM potassium phosphate	7	ambient	278
2	2D NOESY	1-1.5mM B2 NA, in 5mM potassium phosphate buffer, 50uM EDTA, 0.02% NaN3	99.999% D2O	5mM potassium phosphate	7	ambient	298
3	2D TOCSY	1-1.5mM B2 NA, in 5mM potassium phosphate buffer, 50uM EDTA, 0.02% NaN3	99.999% D2O	5mM potassium phosphate	7	ambient	298
4	DQF-COSY	1-1.5mM B2 NA, in 5mM potassium phosphate buffer, 50uM EDTA, 0.02% NaN3	99.999% D2O	5mM potassium phosphate	7	ambient	298
5	1H-13C HSQC or HMQC	1mM B2 U 15N/13C, in 5mM potassium phosphate buffer, 50uM EDTa, 0.02% NaN3	99.999% D2O	5mM potassium phosphate	7	ambient	298
6	1H-15N HMQC	1mM B2 U 15N/13C, in 5mM potassium phosphate buffer, 50uM EDTa, 0.02% NaN3, 95% H2O, 5% D2O	95% H2O/5% D2O	5mM potassium phosphate	7	ambient	278

NMR Spectrometer Information
Spectrometer	Manufacturer	Model	Field Strength
1	Bruker	DMX	500
2	Bruker	DMX	600

NMR Refinement
Method	Details	Software
simulated annealing		XwinNMR

NMR Ensemble Information
Conformer Selection Criteria	all calculated structures submitted,back calculated data agree with experimental NOESY spectrum,structures with acceptable covalent geometry,structures with the least restraint violations,structures with the lowest energy
Conformers Calculated Total Number	17
Conformers Submitted Total Number	17
Representative Model	1 (lowest energy)

Additional NMR Experimental Information
Details	Assignment methodology for this molecule is described in J. Biomol. NMR 9, 259-272 (1997) and Prog. in Nuc. Magn. Resonan. Spec. 32, 287-387 (1998).

Computation: NMR Software
#	Classification	Version	Software Name	Author
1	collection	XwinNMR	2.6	Bruker
2	data analysis	AURELIA	3.108	Bruker
3	structure solution	X-PLOR	NIH	Brunger
4	refinement	X-PLOR	NIH	Brunger

RCSB PDB Core Operations are funded by the National Science Foundation (DBI-1832184), the US Department of Energy (DE-SC0019749), and the National Cancer Institute, National Institute of Allergy and Infectious Diseases, and National Institute of General Medical Sciences of the National Institutes of Health under grant R01GM133198.