Macromolecule Annotations for the Entities in PDB 5BTN

Protein Family Annotation Pfam Database Homepage

Chains Pfam Accession Pfam Identifier Pfam Description Type Source

Gene Product Annotation Gene Ontology Consortium Homepage

Chains Polymer Molecular Function Biological Process Cellular Component
A,C DNA gyrase subunit A (5BTN:A,C)
  • none
B,D DNA gyrase subunit B (5BTN:B,D)
  • none
E,H DNA substrate 24-mer GGTCATGAATGACTATGCACGTAA (5BTN:E,H)
  • none
  • none
  • none
F,G DNA substrate 24-mer TTACGTGCATAGTCATTCATGACC (5BTN:F,G)
  • none
  • none
  • none

Protein Modification Annotation

Type PDB Residue Nr. Description