Structural Similarities for the Entities in PDB 1KX5

The following structural similarities have been found using the jFATCAT-rigid algorithm [1,2].

To reduce the number of hits, a 40% sequence identity clustering has been applied and a representative chain taken from each cluster. If the representative chain consists of multiple domains, each domain is included in the search. If available, the SCOP 1.75 domain assignment [3] is used. Otherwise algorithmic domain assignments are computed using the ProteinDomainParser [4].

Currently viewing only significant results (P-value < 0.001). Show all available results.

Cluster data are up-to-date as of: Nov-29-2016

Info & Help Documentation



A detailed description of the procedure for the all vs. all alignments is available.

Entity #1 | Chains I

Description: DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna | Length: 147

This entity is NOT a polypeptide entity and therefore cannot be considered for the all vs. all structure alignments.


Entity #2 | Chains J

Description: DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna | Length: 147

This entity is NOT a polypeptide entity and therefore cannot be considered for the all vs. all structure alignments.


Entity #3 | Chains A,E

Description: histone H3 protein | Length: 135

No structure alignment results are available for 1KX5.A, 1KX5.E explicitly.

These chains are represented by chain 1TZY.c which has more than 95% sequence identity.

Show structure comparison results

  Loading...

View how chain 1KX5.E compares with the representative chain d1tzyc_. Select a comparison method:


Entity #4 | Chains B,F

Description: histone H4 protein | Length: 102

No structure alignment results are available for 1KX5.B, 1KX5.F explicitly.

These chains are represented by chain 1TZY.d which is 100% sequence identical.

Show structure comparison results

  Loading...

View how chain 1KX5.F compares with the representative chain d1tzyd_. Select a comparison method:


Entity #5 | Chains C,G

Description: histone H2A.1 protein | Length: 128

No structure alignment results are available for 1KX5.C, 1KX5.G explicitly.

These chains are represented by chain 4CAY.A which has more than 50% sequence identity.

Show structure comparison results

  Loading...

View how chain 1KX5.G compares with the representative chain PDP:4CAYAa. Select a comparison method:


Entity #6 | Chains D,H

Description: histone H2B.2 protein | Length: 125

No structure alignment results are available for 1KX5.D, 1KX5.H explicitly.

These chains are represented by chain 1TZY.b which has more than 95% sequence identity.

Show structure comparison results

  Loading...

View how chain 1KX5.H compares with the representative chain d1tzyb_. Select a comparison method:


References