POP-OUT | CLOSE
 
X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution
1KX4

Structural Similarities for the Entities in PDB 1KX4

The following structural similarities have been found using the jFATCAT-rigid algorithm [1,2]. To reduce the number of hits, a 40% sequence identity clustering has been applied and a representative chain taken from each cluster. If the representative chain consists of multiple domains, each domain is included in the search. If available, the SCOP 1.75 domain assignment [3] is used. Otherwise algorithmic domain assignments are computed using the ProteinDomainParser [4].

Entity #1: Chains: I,J
Description: DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna
Length: 146

This entity is not a polypeptide entity and therefore cannot be considered for the all vs. all structure alignments.

 




Entity #2: Chains: A,E
Description: histone H3 protein
Length: 135
No structure alignment results are available for 1KX4.A, 1KX4.E explicitly.

These chains are represented by chain 1TZY.C which has more than 95% sequence identity.

 Click here to show the structure comparison results for representative 1TZY.C

 
 
  Loading...

To see how chain 1KX4.E compares with the representative chain d1tzyc_ select a method below:





Entity #3: Chains: B,F
Description: histone H4 protein
Length: 102
No structure alignment results are available for 1KX4.B, 1KX4.F explicitly.

These chains are represented by chain 1TZY.D which is 100% sequence identical.

 Click here to show the structure comparison results for representative 1TZY.D

 
 
  Loading...

To see how chain 1KX4.F compares with the representative chain d1tzyd_ select a method below:





Entity #4: Chains: C,G
Description: histone H2A.1 protein
Length: 128
No structure alignment results are available for 1KX4.C, 1KX4.G explicitly.

These chains are represented by chain 4CAY.A which has more than 50% sequence identity.

 Click here to show the structure comparison results for representative 4CAY.A

 
 
  Loading...

To see how chain 1KX4.G compares with the representative chain PDP:4CAYAa select a method below:





Entity #5: Chains: D,H
Description: histone H2B.2 protein
Length: 125
No structure alignment results are available for 1KX4.D, 1KX4.H explicitly.

These chains are represented by chain 1TZY.B which has more than 95% sequence identity.

 Click here to show the structure comparison results for representative 1TZY.B

 
 
  Loading...

To see how chain 1KX4.H compares with the representative chain d1tzyb_ select a method below:





  • Update Status Hide
    Oct 14 2014

    Cluster data are up-to-date as of:
     
  • Table Legend Hide
    • Rank: current row position. Changes with different sorting orders and filter rules
    • Domain 2: Domain name of 2nd domain. Can be either a SCOP ID (d<PDB ID><Chain ID><Domain ID>), ProteinDomainParser ID (PDP:<PDB ID><Chain ID><Domain ID>)
    • Title: Protein chain description
    • P-value: P-value of this alignment (FATCAT) (default sorted by this)
    • Score: Raw alignment score (FATCAT)
    • RMSD: RMSD value of the alignment
    • Len1: Domain 1 length
    • Len2: Domain 2 length
    • %ID: % sequence identity in the alignment. A 40% sequence identity filter is applied before the structure alignments are calculated, so most results show low similarity. If the sequences are of vastly different lengths, the clustering procedure will group them in different clusters, even if they share a region of high sequence similarity.
    • %Cov1: The coverage, or %, of aligned residues in chain 1
    • %Cov2: The coverage, or %, of aligned residues in chain 2

    The table is sorting is by P-value by default. Clicking on the column header will change the sort order. Select the Filter Results lense img icon to apply other filtering criteria.

     
Comparison Tool

Calculate pairwise sequence or structure alignments.

PDB 1: Chain 1: ...
PDB 2: Chain 2: ...
Align custom files (Launches a Java Web Start application)
 

Documentation

A detailed description of the procedure for the all vs. all alignments is available.