POP-OUT | CLOSE

An Information Portal to 105025 Biological Macromolecular Structures

Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid
Sequence Clustering and Redundancy Reduction Results
2M90
Sequence Clusters for the Sequence Entities in PDB 2M90
Entity #1: Chains: A - 32-MER DNA dna, length: 32 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.