Sequence Similarity Clusters for the Entities in PDB 1KX5

Entity #1 | Chains: I
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: J
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #3 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 46 264
95 % 4 150 76 Flexibility: Low
Max RMSD: 11.4, Avg RMSD: 1.3
PDBFlex
90 % 4 153 77
70 % 4 154 96
50 % 4 157 131
40 % 4 157 146
30 % 4 157 161
Entity #4 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 4 141 75
95 % 4 160 74 Flexibility: Low
Max RMSD: 13.3, Avg RMSD: 1.2
PDBFlex
90 % 4 165 75
70 % 4 165 87
50 % 4 165 122
40 % 4 165 140
30 % 4 165 155
Entity #5 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 74 166
95 % 2 140 86 Flexibility: Low
Max RMSD: 6.8, Avg RMSD: 0.5
PDBFlex
90 % 2 148 78
70 % 3 154 90
50 % 4 164 120
40 % 4 164 139
30 % 4 164 152
Entity #6 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 55 228
95 % 2 135 111 Flexibility: Low
Max RMSD: 9.7, Avg RMSD: 0.5
PDBFlex
90 % 2 140 107
70 % 2 147 104
50 % 2 147 140
40 % 2 147 156
30 % 2 147 174

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.