Sequence Similarity Clusters for the Entities in PDB 1KX5

Entity #1 | Chains: I
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: J
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #3 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 50 235
95 % 4 158 75 Flexibility: Low
Max RMSD: 11.4, Avg RMSD: 1.2
PDBFlex
90 % 4 161 76
70 % 4 162 89
50 % 4 165 125
40 % 4 165 143
30 % 4 165 157
Entity #4 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 4 149 56
95 % 4 168 71 Flexibility: Low
Max RMSD: 13.3, Avg RMSD: 1.2
PDBFlex
90 % 4 173 72
70 % 4 173 84
50 % 4 173 117
40 % 4 173 139
30 % 4 173 147
Entity #5 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 78 160
95 % 2 148 80 Flexibility: Low
Max RMSD: 6.8, Avg RMSD: 0.6
PDBFlex
90 % 2 156 77
70 % 3 162 87
50 % 4 172 110
40 % 4 172 134
30 % 4 172 143
Entity #6 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 61 203
95 % 2 144 84 Flexibility: Low
Max RMSD: 9.7, Avg RMSD: 0.5
PDBFlex
90 % 2 149 84
70 % 2 156 97
50 % 2 156 134
40 % 2 156 149
30 % 2 156 162

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.