POP-OUT | CLOSE
 
X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX5
Sequence Clusters for the Sequence Entities in PDB 1KX5
Entity #1: Chains: I - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: J - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #3: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 35 276
95% 4 95 81
90% 4 98 84
70% 4 98 104
50% 4 100 139
40% 4 100 167
30% 4 100 190
Entity #4: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 4 82 57
95% 4 97 78
90% 4 101 79
70% 4 101 100
50% 4 101 134
40% 4 101 163
30% 4 101 187
Entity #5: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 55 131
95% 2 84 86
90% 2 90 90
70% 2 93 105
50% 3 99 131
40% 3 99 159
30% 3 99 183
Entity #6: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 41 235
95% 2 84 88
90% 2 86 95
70% 2 92 108
50% 2 92 144
40% 2 92 173
30% 2 92 195
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.