Sequence Similarity Clusters for the Entities in PDB 1KX5

Entity #1 | Chains: I
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: J
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #3 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 1 45 263
95 % 4 147 80
90 % 4 150 79
70 % 4 151 98
50 % 4 154 134
40 % 4 154 149
30 % 4 154 165
Entity #4 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 4 138 77
95 % 4 157 73
90 % 4 162 73
70 % 4 162 87
50 % 4 162 123
40 % 4 162 140
30 % 4 162 156
Entity #5 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 1 72 166
95 % 2 133 110
90 % 2 144 83
70 % 3 150 93
50 % 4 160 120
40 % 4 160 138
30 % 4 160 153
Entity #6 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 1 54 227
95 % 2 132 113
90 % 2 137 111
70 % 2 144 106
50 % 2 144 143
40 % 2 144 159
30 % 2 144 178

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.