POP-OUT | CLOSE

An Information Portal to 105025 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX5
Sequence Clusters for the Sequence Entities in PDB 1KX5
Entity #1: Chains: I - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: J - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #3: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 36 274
95% 4 96 82
90% 4 99 84
70% 4 99 103
50% 4 101 138
40% 4 101 167
30% 4 101 192
Entity #4: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 4 83 70
95% 4 98 80
90% 4 102 80
70% 4 102 98
50% 4 102 133
40% 4 102 161
30% 4 102 187
Entity #5: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 56 137
95% 2 85 87
90% 2 91 91
70% 2 94 104
50% 3 100 130
40% 3 100 158
30% 3 100 184
Entity #6: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 42 237
95% 2 85 89
90% 2 87 96
70% 2 93 111
50% 2 93 152
40% 2 93 176
30% 2 93 198
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.