POP-OUT | CLOSE

An Information Portal to 109093 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX5
Sequence Clusters for the Sequence Entities in PDB 1KX5
Entity #1: Chains: I - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: J - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #3: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 36 283
95% 4 98 120
90% 4 101 110
70% 4 101 129
50% 4 104 165
40% 4 104 186
30% 4 104 203
Entity #4: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 4 84 98
95% 4 100 116
90% 4 104 100
70% 4 104 120
50% 4 104 157
40% 4 104 179
30% 4 104 197
Entity #5: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 56 165
95% 2 86 133
90% 2 92 129
70% 2 95 130
50% 3 101 153
40% 3 101 175
30% 3 101 192
Entity #6: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 42 245
95% 2 86 134
90% 2 88 142
70% 2 94 148
50% 2 94 183
40% 2 94 200
30% 2 94 216
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.