Sequence Similarity Clusters for the Entities in PDB 1KX5

Entity #1 | Chains: I
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: J
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #3 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 1 47 251
95 % 4 151 76
90 % 4 154 78
70 % 4 155 93
50 % 4 158 128
40 % 4 158 145
30 % 4 158 160
Entity #4 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 4 142 62
95 % 4 161 74
90 % 4 166 73
70 % 4 166 86
50 % 4 166 122
40 % 4 166 140
30 % 4 166 154
Entity #5 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 1 75 164
95 % 2 141 81
90 % 2 149 79
70 % 3 155 89
50 % 4 165 116
40 % 4 165 138
30 % 4 165 150
Entity #6 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 1 56 217
95 % 2 136 108
90 % 2 141 91
70 % 2 148 100
50 % 2 148 139
40 % 2 148 156
30 % 2 148 172

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.