POP-OUT | CLOSE

An Information Portal to 111749 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX5
Sequence Clusters for the Sequence Entities in PDB 1KX5
Entity #1: Chains: I - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: J - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #3: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 38 271
95% 4 102 121
90% 4 105 126
70% 4 105 141
50% 4 108 163
40% 4 108 183
30% 4 108 197
Entity #4: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 4 92 95
95% 4 109 113
90% 4 113 97
70% 4 113 117
50% 4 113 152
40% 4 113 169
30% 4 113 186
Entity #5: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 58 162
95% 2 88 136
90% 2 95 132
70% 2 98 146
50% 3 104 164
40% 3 104 184
30% 3 104 198
Entity #6: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 44 232
95% 2 88 137
90% 2 90 146
70% 2 97 153
50% 2 97 182
40% 2 97 197
30% 2 97 215
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.