POP-OUT | CLOSE

An Information Portal to 107754 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX5
Sequence Clusters for the Sequence Entities in PDB 1KX5
Entity #1: Chains: I - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: J - DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #3: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 36 282
95% 4 98 98
90% 4 101 103
70% 4 101 123
50% 4 104 159
40% 4 104 181
30% 4 104 198
Entity #4: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 4 84 92
95% 4 100 96
90% 4 104 95
70% 4 104 114
50% 4 104 153
40% 4 104 176
30% 4 104 195
Entity #5: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 56 160
95% 2 86 129
90% 2 92 106
70% 2 95 124
50% 3 101 150
40% 3 101 174
30% 3 101 192
Entity #6: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 1 42 241
95% 2 86 131
90% 2 88 137
70% 2 94 128
50% 2 94 172
40% 2 94 193
30% 2 94 209
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.