Sequence Similarity Clusters for the Entities in PDB 1KX5

Entity #1 | Chains: I
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: J
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') dna, length: 147 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #3 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 54 239
95 % 4 166 77 Flexibility: Low
Max RMSD: 11.4, Avg RMSD: 1.2
PDBFlex
90 % 4 169 80
70 % 4 170 94
50 % 4 174 124
40 % 4 174 144
30 % 4 174 151
Entity #4 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 4 159 57
95 % 4 178 68 Flexibility: Low
Max RMSD: 13.3, Avg RMSD: 1.2
PDBFlex
90 % 4 183 70
70 % 4 183 86
50 % 4 183 115
40 % 4 183 139
30 % 4 183 144
Entity #5 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 86 128
95 % 2 161 78 Flexibility: Low
Max RMSD: 6.8, Avg RMSD: 0.6
PDBFlex
90 % 2 169 75
70 % 3 175 89
50 % 4 185 108
40 % 4 185 130
30 % 4 185 139
Entity #6 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 1 68 195
95 % 2 155 89 Flexibility: Low
Max RMSD: 9.7, Avg RMSD: 0.5
PDBFlex
90 % 2 160 86
70 % 2 167 99
50 % 2 167 136
40 % 2 167 149
30 % 2 167 159

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.

You can also use the structure comparison tool to compare any 2 given structures