Sequence Similarity Clusters for the Entities in PDB 1KX4

Entity #1 | Chains: I,J
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 23 42 252
95 % 68 126 103
90 % 68 129 103
70 % 69 130 116
50 % 71 133 142
40 % 71 133 156
30 % 71 133 175
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 64 117 85
95 % 74 135 78
90 % 75 140 78
70 % 75 140 92
50 % 75 140 130
40 % 75 140 144
30 % 75 140 163
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 35 66 129
95 % 59 114 112
90 % 63 123 106
70 % 64 127 106
50 % 67 134 129
40 % 67 134 143
30 % 67 134 162
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 27 49 225
95 % 57 113 116
90 % 59 116 117
70 % 61 122 128
50 % 61 122 155
40 % 61 122 169
30 % 61 122 185

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.