POP-OUT | CLOSE

An Information Portal to 106082 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX4
Sequence Clusters for the Sequence Entities in PDB 1KX4
Entity #1: Chains: I,J - DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 20 36 279
95% 52 97 84
90% 52 100 88
70% 52 100 111
50% 54 103 143
40% 54 103 171
30% 54 103 192
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 45 84 74
95% 53 99 82
90% 54 103 81
70% 54 103 99
50% 54 103 137
40% 54 103 166
30% 54 103 188
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 29 56 139
95% 42 86 97
90% 45 92 91
70% 45 95 110
50% 47 101 134
40% 47 101 164
30% 47 101 186
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 23 42 238
95% 43 86 105
90% 43 88 104
70% 45 94 113
50% 45 94 155
40% 45 94 182
30% 45 94 202
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.