Sequence Similarity Clusters for the Entities in PDB 1KX4

Entity #1 | Chains: I,J
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 27 50 238
95 % 86 160 77 Flexibility: Low
Max RMSD: 11.4, Avg RMSD: 1.2
PDBFlex
90 % 86 163 76
70 % 87 164 92
50 % 89 167 124
40 % 89 167 145
30 % 89 167 155
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 83 151 58
95 % 93 170 71 Flexibility: Low
Max RMSD: 13.3, Avg RMSD: 1.2
PDBFlex
90 % 94 175 69
70 % 94 175 83
50 % 94 175 116
40 % 94 175 139
30 % 94 175 144
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 41 79 161
95 % 78 150 81 Flexibility: Low
Max RMSD: 6.8, Avg RMSD: 0.6
PDBFlex
90 % 82 158 78
70 % 84 164 89
50 % 89 174 111
40 % 89 174 135
30 % 89 174 141
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 34 63 199
95 % 74 146 84 Flexibility: Low
Max RMSD: 9.7, Avg RMSD: 0.5
PDBFlex
90 % 77 151 85
70 % 80 158 98
50 % 80 158 135
40 % 80 158 151
30 % 80 158 161

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.