Sequence Similarity Clusters for the Entities in PDB 1KX4

Entity #1 | Chains: I,J
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 27 50 234
95 % 83 157 76 Flexibility: Low
Max RMSD: 11.4, Avg RMSD: 1.1
PDBFlex
90 % 83 160 77
70 % 84 161 89
50 % 86 164 125
40 % 86 164 141
30 % 86 164 155
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 80 148 56
95 % 90 167 70 Flexibility: Low
Max RMSD: 13.3, Avg RMSD: 1.2
PDBFlex
90 % 91 172 72
70 % 91 172 85
50 % 91 172 117
40 % 91 172 138
30 % 91 172 147
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 40 78 158
95 % 75 147 78 Flexibility: Low
Max RMSD: 6.7, Avg RMSD: 0.5
PDBFlex
90 % 79 155 78
70 % 81 161 87
50 % 86 171 111
40 % 86 171 134
30 % 86 171 143
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 31 60 202
95 % 71 143 85 Flexibility: Low
Max RMSD: 9.7, Avg RMSD: 0.5
PDBFlex
90 % 74 148 85
70 % 77 155 95
50 % 77 155 133
40 % 77 155 148
30 % 77 155 163

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.