Sequence Similarity Clusters for the Entities in PDB 1KX4

Entity #1 | Chains: I,J
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 26 46 266
95 % 81 150 77 Flexibility: Low
Max RMSD: 11.4, Avg RMSD: 1.2
PDBFlex
90 % 81 153 78
70 % 82 154 96
50 % 84 157 132
40 % 84 157 147
30 % 84 157 161
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 78 141 76
95 % 88 160 75 Flexibility: Low
Max RMSD: 13.3, Avg RMSD: 1.2
PDBFlex
90 % 89 165 75
70 % 89 165 86
50 % 89 165 124
40 % 89 165 140
30 % 89 165 155
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 39 74 166
95 % 73 140 86 Flexibility: Low
Max RMSD: 6.8, Avg RMSD: 0.5
PDBFlex
90 % 77 148 79
70 % 79 154 90
50 % 84 164 120
40 % 84 164 139
30 % 84 164 152
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 30 55 228
95 % 69 135 111 Flexibility: Low
Max RMSD: 9.7, Avg RMSD: 0.5
PDBFlex
90 % 72 140 107
70 % 75 147 103
50 % 75 147 140
40 % 75 147 157
30 % 75 147 174

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.