POP-OUT | CLOSE

An Information Portal to 110790 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX4
Sequence Clusters for the Sequence Entities in PDB 1KX4
Entity #1: Chains: I,J - DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 20 36 284
95% 53 100 123
90% 53 103 127
70% 53 103 144
50% 55 106 166
40% 55 106 183
30% 55 106 198
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 48 90 96
95% 57 107 118
90% 58 111 114
70% 58 111 129
50% 58 111 155
40% 58 111 172
30% 58 111 187
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 29 56 173
95% 42 86 136
90% 45 93 132
70% 45 96 149
50% 47 102 167
40% 47 102 184
30% 47 102 199
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 23 42 248
95% 43 86 137
90% 43 88 146
70% 45 95 152
50% 45 95 184
40% 45 95 201
30% 45 95 217
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.