POP-OUT | CLOSE

An Information Portal to 106858 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX4
Sequence Clusters for the Sequence Entities in PDB 1KX4
Entity #1: Chains: I,J - DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 20 36 281
95% 53 98 97
90% 53 101 103
70% 53 101 123
50% 55 104 158
40% 55 104 180
30% 55 104 198
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 45 84 87
95% 54 100 95
90% 55 104 95
70% 55 104 112
50% 55 104 151
40% 55 104 175
30% 55 104 194
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 29 56 143
95% 42 86 124
90% 45 92 105
70% 45 95 124
50% 47 101 148
40% 47 101 173
30% 47 101 192
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 23 42 239
95% 43 86 126
90% 43 88 121
70% 45 94 126
50% 45 94 169
40% 45 94 191
30% 45 94 209
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.