Sequence Similarity Clusters for the Entities in PDB 1KX4

Entity #1 | Chains: I,J
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 37 71 205
95 % 89 172 75 Flexibility: Low
Max RMSD: 11.4, Avg RMSD: 1.1
PDBFlex
90 % 89 177 78
70 % 90 178 92
50 % 92 182 124
40 % 92 182 145
30 % 92 182 156
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 93 183 55
95 % 96 186 70 Flexibility: Low
Max RMSD: 13.3, Avg RMSD: 1.2
PDBFlex
90 % 97 192 71
70 % 97 192 85
50 % 97 192 115
40 % 97 192 137
30 % 97 192 147
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 43 91 168
95 % 80 168 76 Flexibility: Low
Max RMSD: 6.8, Avg RMSD: 0.5
PDBFlex
90 % 84 176 75
70 % 86 182 90
50 % 92 193 110
40 % 92 193 132
30 % 92 193 144
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 37 75 196
95 % 77 162 87 Flexibility: No
Max RMSD: 9.7, Avg RMSD: 0.5
PDBFlex
90 % 77 162 91
70 % 83 174 99
50 % 83 174 132
40 % 83 174 149
30 % 83 174 163

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.

You can also use the structure comparison tool to compare any 2 given structures