Sequence Similarity Clusters for the Entities in PDB 1KX4

Entity #1 | Chains: I,J
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 37 71 201
95 % 86 168 77 Flexibility: Low
Max RMSD: 11.4, Avg RMSD: 1.1
PDBFlex
90 % 86 171 79
70 % 87 172 97
50 % 89 176 125
40 % 89 176 145
30 % 89 176 159
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 90 178 56
95 % 93 181 70 Flexibility: Low
Max RMSD: 13.3, Avg RMSD: 1.2
PDBFlex
90 % 94 185 72
70 % 94 185 89
50 % 94 185 119
40 % 94 185 141
30 % 94 185 151
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 43 88 160
95 % 78 163 79 Flexibility: Low
Max RMSD: 6.8, Avg RMSD: 0.5
PDBFlex
90 % 82 171 74
70 % 84 177 90
50 % 89 187 112
40 % 89 187 133
30 % 89 187 144
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name Structural variation in cluster
100 % 37 73 195
95 % 74 157 105 Flexibility: No
Max RMSD: 9.7, Avg RMSD: 0.5
PDBFlex
90 % 74 157 109
70 % 80 169 101
50 % 80 169 136
40 % 80 169 152
30 % 80 169 167

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.

You can also use the structure comparison tool to compare any 2 given structures