Sequence Similarity Clusters for the Entities in PDB 1KX4

Entity #1 | Chains: I,J
DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 26 46 260
95 % 80 149 76
90 % 80 152 78
70 % 81 153 96
50 % 83 156 131
40 % 83 156 145
30 % 83 156 160
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 77 140 75
95 % 87 159 73
90 % 88 164 74
70 % 88 164 87
50 % 88 164 122
40 % 88 164 139
30 % 88 164 155
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 39 74 164
95 % 72 139 86
90 % 76 147 80
70 % 78 153 88
50 % 83 163 117
40 % 83 163 138
30 % 83 163 150
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 30 55 224
95 % 68 134 111
90 % 71 139 108
70 % 74 146 104
50 % 74 146 140
40 % 74 146 155
30 % 74 146 172

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.