POP-OUT | CLOSE

An Information Portal to 110071 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP146b, at 2.6 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX4
Sequence Clusters for the Sequence Entities in PDB 1KX4
Entity #1: Chains: I,J - DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 20 36 283
95% 53 98 124
90% 53 101 131
70% 53 101 148
50% 55 104 174
40% 55 104 192
30% 55 104 208
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 48 87 101
95% 57 103 122
90% 58 107 124
70% 58 107 139
50% 58 107 164
40% 58 107 181
30% 58 107 197
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 29 56 172
95% 42 86 135
90% 45 92 133
70% 45 95 149
50% 47 101 165
40% 47 101 182
30% 47 101 199
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 23 42 245
95% 43 86 136
90% 43 88 145
70% 45 94 153
50% 45 94 186
40% 45 94 202
30% 45 94 217
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.