POP-OUT | CLOSE

An Information Portal to 105339 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX3
Sequence Clusters for the Sequence Entities in PDB 1KX3
Entity #1: Chains: I,J - DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 36 276
95% 10 97 83
90% 10 100 85
70% 10 100 104
50% 10 103 138
40% 10 103 167
30% 10 103 191
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 10 84 68
95% 10 99 81
90% 10 103 80
70% 10 103 98
50% 10 103 134
40% 10 103 162
30% 10 103 187
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 56 146
95% 5 86 88
90% 5 92 90
70% 5 95 103
50% 6 101 131
40% 6 101 160
30% 6 101 185
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 42 238
95% 5 86 89
90% 5 88 97
70% 5 94 109
50% 5 94 149
40% 5 94 177
30% 5 94 197
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.