Sequence Similarity Clusters for the Entities in PDB 1KX3

Entity #1 | Chains: I,J
DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 43 246
95 % 12 134 101
90 % 12 137 102
70 % 12 138 104
50 % 12 141 136
40 % 12 141 152
30 % 12 141 173
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 12 125 83
95 % 12 144 75
90 % 12 149 74
70 % 12 149 88
50 % 12 149 126
40 % 12 149 145
30 % 12 149 157
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 68 146
95 % 7 123 111
90 % 7 132 104
70 % 8 136 97
50 % 9 146 124
40 % 9 146 142
30 % 9 146 154
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 50 223
95 % 7 122 113
90 % 7 125 116
70 % 7 131 123
50 % 7 131 151
40 % 7 131 170
30 % 7 131 184

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.