Sequence Similarity Clusters for the Entities in PDB 1KX3

Entity #1 | Chains: I,J
DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 45 247
95 % 12 137 105
90 % 12 140 105
70 % 12 141 116
50 % 12 144 140
40 % 12 144 157
30 % 12 144 173
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 12 128 86
95 % 12 147 78
90 % 12 152 74
70 % 12 152 91
50 % 12 152 128
40 % 12 152 146
30 % 12 152 160
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 70 161
95 % 7 125 111
90 % 7 134 107
70 % 8 140 99
50 % 9 150 124
40 % 9 150 141
30 % 9 150 155
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 52 223
95 % 7 124 116
90 % 7 127 116
70 % 7 134 124
50 % 7 134 154
40 % 7 134 170
30 % 7 134 186

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.