POP-OUT | CLOSE

An Information Portal to 107049 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX3
Sequence Clusters for the Sequence Entities in PDB 1KX3
Entity #1: Chains: I,J - DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 36 281
95% 10 98 97
90% 10 101 103
70% 10 101 123
50% 10 104 158
40% 10 104 180
30% 10 104 198
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 10 84 88
95% 10 100 95
90% 10 104 95
70% 10 104 112
50% 10 104 151
40% 10 104 175
30% 10 104 194
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 56 143
95% 5 86 125
90% 5 92 105
70% 5 95 124
50% 6 101 148
40% 6 101 173
30% 6 101 192
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 42 239
95% 5 86 127
90% 5 88 122
70% 5 94 126
50% 5 94 169
40% 5 94 191
30% 5 94 209
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.