POP-OUT | CLOSE

An Information Portal to 110071 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX3
Sequence Clusters for the Sequence Entities in PDB 1KX3
Entity #1: Chains: I,J - DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 36 283
95% 10 98 124
90% 10 101 131
70% 10 101 148
50% 10 104 174
40% 10 104 192
30% 10 104 208
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 10 87 101
95% 10 103 122
90% 10 107 124
70% 10 107 139
50% 10 107 164
40% 10 107 181
30% 10 107 197
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 56 172
95% 5 86 135
90% 5 92 133
70% 5 95 149
50% 6 101 165
40% 6 101 182
30% 6 101 199
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 42 245
95% 5 86 136
90% 5 88 145
70% 5 94 153
50% 5 94 186
40% 5 94 202
30% 5 94 217
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.