Sequence Similarity Clusters for the Entities in PDB 1KX3

Entity #1 | Chains: I,J
DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 46 260
95 % 12 149 76
90 % 12 152 78
70 % 12 153 96
50 % 12 156 131
40 % 12 156 145
30 % 12 156 160
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 12 140 75
95 % 12 159 73
90 % 12 164 74
70 % 12 164 87
50 % 12 164 122
40 % 12 164 139
30 % 12 164 155
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 74 164
95 % 7 139 86
90 % 7 147 80
70 % 8 153 88
50 % 9 163 117
40 % 9 163 138
30 % 9 163 150
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 55 224
95 % 7 134 111
90 % 7 139 108
70 % 7 146 104
50 % 7 146 140
40 % 7 146 155
30 % 7 146 172

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.