POP-OUT | CLOSE
 
X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX3
Sequence Clusters for the Sequence Entities in PDB 1KX3
Entity #1: Chains: I,J - DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 35 278
95% 10 95 82
90% 10 98 85
70% 10 98 105
50% 10 100 139
40% 10 100 168
30% 10 100 191
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 10 82 57
95% 10 97 79
90% 10 101 80
70% 10 101 100
50% 10 101 134
40% 10 101 163
30% 10 101 187
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 55 132
95% 5 84 86
90% 5 90 91
70% 5 93 106
50% 6 99 131
40% 6 99 159
30% 6 99 183
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 41 237
95% 5 84 88
90% 5 86 96
70% 5 92 109
50% 5 92 146
40% 5 92 174
30% 5 92 196
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.