POP-OUT | CLOSE

An Information Portal to 110988 Biological Macromolecular Structures

X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution
Sequence Clustering and Redundancy Reduction Results
1KX3
Sequence Clusters for the Sequence Entities in PDB 1KX3
Entity #1: Chains: I,J - DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
Entity #2: Chains: A,E - histone H3 protein, length: 135 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 36 284
95% 10 100 123
90% 10 103 127
70% 10 103 144
50% 10 106 166
40% 10 106 183
30% 10 106 198
Entity #3: Chains: B,F - histone H4 protein, length: 102 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 10 90 96
95% 10 107 118
90% 10 111 114
70% 10 111 129
50% 10 111 155
40% 10 111 173
30% 10 111 186
Entity #4: Chains: C,G - histone H2A.1 protein, length: 128 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 56 181
95% 5 86 136
90% 5 93 132
70% 5 96 149
50% 6 102 167
40% 6 102 184
30% 6 102 199
Entity #5: Chains: D,H - histone H2B.2 protein, length: 125 [Blast  ]
Cluster Sequence Similarity Cutoff Rank   Nr. of chains in Cluster Cluster Nr.  
100% 3 42 248
95% 5 86 137
90% 5 88 146
70% 5 95 152
50% 5 95 185
40% 5 95 202
30% 5 95 218
 

Documentation

Click here for more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB.