Sequence Similarity Clusters for the Entities in PDB 1KX3

Entity #1 | Chains: I,J
DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 42 253
95 % 12 126 106
90 % 12 129 107
70 % 12 130 122
50 % 12 133 145
40 % 12 133 161
30 % 12 133 179
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 12 117 89
95 % 12 135 99
90 % 12 140 84
70 % 12 140 98
50 % 12 140 134
40 % 12 140 146
30 % 12 140 167
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 66 133
95 % 7 115 115
90 % 7 124 109
70 % 8 128 117
50 % 9 135 133
40 % 9 135 145
30 % 9 135 165
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 49 227
95 % 7 114 118
90 % 7 117 119
70 % 7 123 129
50 % 7 123 155
40 % 7 123 171
30 % 7 123 186

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.