Sequence Similarity Clusters for the Entities in PDB 1KX3

Entity #1 | Chains: I,J
DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') dna, length: 146 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
Entity #2 | Chains: A,E
histone H3 protein, length: 135 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 45 259
95 % 12 143 90
90 % 12 146 83
70 % 12 147 101
50 % 12 150 136
40 % 12 150 152
30 % 12 150 169
Entity #3 | Chains: B,F
histone H4 protein, length: 102 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 12 134 78
95 % 12 153 72
90 % 12 158 73
70 % 12 158 88
50 % 12 158 127
40 % 12 158 142
30 % 12 158 158
Entity #4 | Chains: C,G
histone H2A.1 protein, length: 128 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 70 164
95 % 7 129 112
90 % 7 140 84
70 % 8 146 93
50 % 9 156 121
40 % 9 156 139
30 % 9 156 155
Entity #5 | Chains: D,H
histone H2B.2 protein, length: 125 (BLAST)
Sequence Similarity Cutoff Rank Chains in Cluster Cluster ID / Name
100 % 3 52 230
95 % 7 128 114
90 % 7 133 113
70 % 7 140 119
50 % 7 140 147
40 % 7 140 162
30 % 7 140 182

Instructions

In the table for each entity, view a list of similar sequences by selecting the link associated with the percentage cutoff.



View more detailed documentation on the redundancy reduction and sequence clustering procedure used by RCSB PDB.