An Information Portal to 105212 Biological Macromolecular Structures

Structure of d[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex hybrid

Sequence Display  

The sequence display provides a graphical representation of the UniProtKB, PDB - ATOM and PDB - SEQRES sequences. Different 3rd party annotations can be graphically mapped on the sequence and displayed in the Jmol viewer.

The structure 2M93 has in total 1 chains.

Currently viewing unique chains only. show all chains
Sequence & Structure Relationships

  Enable Jmol to view annotations in 3D.

Chain A : 32-MER DNA
FASTA | Sequence & DSSP | Image
Polymer 1
Length: 32 residues
Chain Type: polydeoxyribonucleotide
Display Parameters
No parameters are available for this sequence
Mouse over an annotation to see more details. Click annotation to enable Jmol.
Jmol parameters
  Show Jmol
  Jmol width Jmol height
Page parameters
  Font size Residues per row
The PDB to UniProt mapping is based on the data provided by the EBI SIFTS project. See also Velankar et al., Nucleic Acids Research 33, D262-265 (2005).
Enable Jmol?  
You need to enable Jmol to view annotations in 3D.   Enable Jmol now?