X-RAY DIFFRACTION Experimental Data & Validation


X-ray Experimental Help

Crystallization

Crystalization Experiments
Method Vapor Diffusion Hanging Drop
pH 6.2
Temperature 298.0
Details Peg2000, sodium cacodylate, sodium fluoride, magnesium chloride, sucrose monolaurate, dATP, DNA hairpin (5' TTTTTTTTTTAGATGTCGATGCAATCGACATCT* 3' terminated by 3'deoxythymine ), pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K

Crystal Data

Unit Cell
Length (Å) Angle (°)
a = 113.04 α = 90
b = 113.04 β = 90
c = 62.58 γ = 120
Symmetry
Space Group P 62

Diffraction

Diffraction Experiment
ID # Data Collection Temperature
1 100
Diffraction Detector
Detector Diffraction Type Details Collection Date
CCD BRANDEIS - B4 Wiggler 2001-07-26
Diffraction Radiation
Monochromator Protocol
Si 111 channel SINGLE WAVELENGTH
Diffraction Detector Source
Source Type Wavelength List Synchrotron Site Beamline
SYNCHROTRON NSLS BEAMLINE X25 1.1 NSLS X25

Data Collection

Overall
Resolution (High) Resolution (Low) Percent Possible (Observed) R Merge I (Observed) R Sym I (Observed) Net I Over Average Sigma (I) Redundancy Number Reflections (All) Number Reflections (Observed) Observed Criterion Sigma (F) Observed Criterion Sigma (I) B (Isotropic) From Wilson Plot
2.8 37 99.9 0.08 -- -- 7.1 11002 11002 0.0 0.0 --
High Resolution Shell
Resolution (High) Resolution (Low) Percent Possible (All) R Merge I (Observed) R-Sym I (Observed) Mean I Over Sigma (Observed) Redundancy Number Unique Reflections (All)
2.8 2.9 100.0 0.501 -- 4.7 7.1 1126

Refinement

Statistics
Structure Solution Method Refinement High Resolution Refinement Low Resolution Cut-off Sigma (I) Cut-off Sigma (F) Number of Reflections (All) Number of Reflections (Observed) Number of Reflections (R-Free) Percent Reflections (Observed) R-Factor (All) R-Factor (Observed) R-Work R-Free R-Free Selection Details
MOLECULAR REPLACEMENT 2.8 37.0 -- 0.0 11002 11002 1159 96.6 -- -- 0.237 0.279 RANDOM
High Resolution Shell
Refinement method Shell Resolution (High) Shell Resolution (Low) # of Reflections (Observed) # of Reflections (R-Free) # of Reflections (R-Work) R-Factor (R-Work) R-Factor (R-Free) R-Factor (R-Free Error) Percent Reflections (Observed)
X Ray Diffraction 2.8 2.98 -- 175 1537 0.338 0.426 0.032 90.6
Temperature Factor Modeling
Temperature Factor Value
Isotropic Thermal Model RESTRAINED
Mean Isotropic B 72.9
Anisotropic B[1][1] 9.28
Anisotropic B[1][2] 19.43
Anisotropic B[1][3] 0.0
Anisotropic B[2][2] 10.26
Anisotropic B[2][3] 0.0
Anisotropic B[3][3] -19.54
RMS Deviations
Key Refinement Restraint Deviation
c_scangle_it 3.46
c_scbond_it 2.7
c_mcangle_it 2.14
c_mcbond_it 1.24
c_improper_angle_d 0.7
c_dihedral_angle_d 21.1
c_angle_deg 0.9
c_bond_d 0.004
Coordinate Error
Parameter Value
Luzzati ESD (Observed) 0.39
Luzzati Sigma A (Observed) 0.48
Luzzati Resolution Cutoff (Low) 5.0
Luzzati ESD (R-Free Set) 0.52
Luzzati Sigma A (R-Free Set) 0.62
Number of Non-Hydrogen Atoms Used in Refinement
Non-Hydrogen Atoms Numbers
Protein Atoms 2671
Nucleic Acid Atoms 0
Heterogen Atoms 0
Solvent Atoms 31

Software

Computing
Computing Package Purpose
DENZO Data Reduction (intensity integration)
SCALEPACK Data Reduction (data scaling)
AMORE Structure Solution
CNS 1.0 Structure Refinement
Software
Software Name Purpose
CNS version: 1.0 refinement
AMoRE model building