X-RAY DIFFRACTION Experimental Data & Validation

X-ray Experimental Help


Crystalization Experiments
Method Vapor Diffusion Hanging Drop
pH 6.2
Temperature 298.0
Details Peg2000, sodium cacodylate, sodium fluoride, magnesium chloride, sucrose monolaurate, dATP, DNA hairpin (5' TTTTTTTTTTAGATGTCGATGCAATCGACATCT* 3' terminated by 3'deoxythymine ), pH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 298.0K

Crystal Data

Unit Cell
Length (Å) Angle (°)
a = 113.04 α = 90
b = 113.04 β = 90
c = 62.58 γ = 120
Space Group P 62


Diffraction Experiment
ID # Data Collection Temperature
1 100
Diffraction Detector
Detector Diffraction Type Details Collection Date
CCD BRANDEIS - B4 Wiggler 2001-07-26
Diffraction Radiation
Monochromator Protocol
Diffraction Detector Source
Source Type Wavelength List Synchrotron Site Beamline

Data Collection

Resolution (High) Resolution (Low) Percent Possible (Observed) R Merge I (Observed) R Sym I (Observed) Net I Over Average Sigma (I) Redundancy Number Reflections (All) Number Reflections (Observed) Observed Criterion Sigma (F) Observed Criterion Sigma (I) B (Isotropic) From Wilson Plot
2.8 37 99.9 0.08 -- -- 7.1 11002 11002 0.0 0.0 --
High Resolution Shell
Resolution (High) Resolution (Low) Percent Possible (All) R Merge I (Observed) R-Sym I (Observed) Mean I Over Sigma (Observed) Redundancy Number Unique Reflections (All)
2.8 2.9 100.0 0.501 -- 4.7 7.1 1126


Structure Solution Method Refinement High Resolution Refinement Low Resolution Cut-off Sigma (I) Cut-off Sigma (F) Number of Reflections (All) Number of Reflections (Observed) Number of Reflections (R-Free) Percent Reflections (Observed) R-Factor (All) R-Factor (Observed) R-Work R-Free R-Free Selection Details
MOLECULAR REPLACEMENT 2.8 37.0 -- 0.0 11002 11002 1159 96.6 -- -- 0.237 0.279 RANDOM
High Resolution Shell
Refinement method Shell Resolution (High) Shell Resolution (Low) # of Reflections (Observed) # of Reflections (R-Free) # of Reflections (R-Work) R-Factor (R-Work) R-Factor (R-Free) R-Factor (R-Free Error) Percent Reflections (Observed)
X Ray Diffraction 2.8 2.98 -- 175 1537 0.338 0.426 0.032 90.6
Temperature Factor Modeling
Temperature Factor Value
Isotropic Thermal Model RESTRAINED
Mean Isotropic B 72.9
Anisotropic B[1][1] 9.28
Anisotropic B[1][2] 19.43
Anisotropic B[1][3] 0.0
Anisotropic B[2][2] 10.26
Anisotropic B[2][3] 0.0
Anisotropic B[3][3] -19.54
RMS Deviations
Key Refinement Restraint Deviation
c_improper_angle_d 0.7
c_bond_d 0.004
c_dihedral_angle_d 21.1
c_scangle_it 3.46
c_mcbond_it 1.24
c_angle_deg 0.9
c_scbond_it 2.7
c_mcangle_it 2.14
Coordinate Error
Parameter Value
Luzzati ESD (Observed) 0.39
Luzzati Sigma A (Observed) 0.48
Luzzati Resolution Cutoff (Low) 5.0
Luzzati ESD (R-Free Set) 0.52
Luzzati Sigma A (R-Free Set) 0.62
Number of Non-Hydrogen Atoms Used in Refinement
Non-Hydrogen Atoms Numbers
Protein Atoms 2671
Nucleic Acid Atoms 0
Heterogen Atoms 0
Solvent Atoms 31


Software Name Purpose
AMoRE phasing
CNS refinement version: 1.0
DENZO data reduction
SCALEPACK data scaling