Citations in PubMed

Primary Citation PubMed: 18619463 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 6

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

Molecular models for intrastrand DNA G-quadruplexes.

(2009) BMC Struct Biol 9

PubMed: 19811654 | PubMedCentral: PMC2768733 | DOI: 10.1186/1472-6807-9-64

143D , 186D , 1KF1 , 1XAV , 230D , 2F8U , 2GKU , 2HY9 , 2JPZ , 2JSL , 2JSM , 2O3M , 201D , 3CDM ), including 230D which contains the nucleotides uridine and inosine-phosphate.

1KF1 , 2GKU , 2HY9 , 2JPZ , 2JSL , 2JSM and 3CDM all contain the core sequence GGGTTAGGGTTAGGGTTAGGG and adopt three different topologies: namely -p-p-p, -l-l-p, -p-l-l.

Publication Year: 2009


Structure, localization and histone binding properties of nuclear-associated nucleosome assembly protein from Plasmodium falciparum.

(2010) Malar J 9

PubMed: 20377878 | PubMedCentral: PMC2873526 | DOI: 10.1186/1475-2875-9-90

Protein, PDB code Annotation Localization r.m.s.d of Cα, Å (number of Cα matched) Length of dimerization helix α2 (r.m.s.d, Å) PfNapS, 3KYP malaria parasite Nap... Primarily nuclear 41 PfNapL, 3FS3 [ 6 - 8 ] Malaria parasite NapL Primarily cytoplasmic 1.94 (144) 51 (0.9) hSET, 2E50 [ 10 , 31 ] Human SET/TAF-Iβ/INHAT functional domain Nucleocytoplasmic 1.6 (139) 54 (0.75) yNAP-1, 2AYU [ 9 , 32 ] Yeast NAP-1 Nucleocytoplasmic 1.9 (112) 51 (1.0) Vps75, 3CDM [ 11 , 12 , 33 ] Yeast NAP Primarily nuclear 2.0 (124) 42 (0.9) Comparison of root mean square deviation (r.m.s.d) of NAP/SET monomers and length of dimerization helix α2 with PfNapS monomer.

Publication Year: 2010


The crystal structure of human telomeric DNA complexed with berberine: an interesting case of stacked ligand to G-tetrad ratio higher than 1:1.

(2013) Nucleic Acids Res 41

PubMed: 23104378 | PubMedCentral: PMC3592469 | DOI: 10.1093/nar/gks1001

Coordinates of the complex of the same DNA sequence with a tetra-substituted naphthalene diimide ( 9 ) (PDB code: 3CDM) were used as a search model, after deleting atoms belonging to ligand and solven... molecules.

Publication Year: 2013


Bis-indole derivatives with antitumor activity turn out to be specific ligands of human telomeric G-quadruplex.

(2014) Front Chem 2

PubMed: 25105115 | PubMedCentral: PMC4109613 | DOI: 10.3389/fchem.2014.00054

The total volume loaded in each well was 10 μL. Molecular docking The crystal structure of the 23-mer human telomeric G-quadruplex DNA 5′-TAGGGTTAGGGTTAGGGTTAGGG-3′ bound to a ... etra-substituted naphthalene diimide ligand (PDB code 3CDM) was used as the target for docking studies (Parkinson et al., 2008 ).

We docked the ligands to an X-ray crystal structure of the parallel 23-mer human telomeric G4 (PDB ID 3CDM) using AutoDock (Morris et al., 2009 ).

Publication Year: 2014


Pyrrolobenzodiazepines (PBDs) do not bind to DNA G-quadruplexes.

(2014) PLoS One 9

PubMed: 25133504 | PubMedCentral: PMC4136862 | DOI: 10.1371/journal.pone.0105021

The crystal structure of a telomeric G-quadruplex (PDB ID: 3CDM) was taken as a starting point to study plausible interactions with 5 and 9 .

Receptor Preparation Structural co-ordinates of the G-quadruplex receptor file were obtained from the Protein Data Bank (PDB ID: 3CDM) [58] .

Publication Year: 2014


PubMed ID is not available.

Published in 2015

PubMedCentral: PMC4446451

The only significant deviation can be seen for a 23-mer-naphthalene diimide derivative complex structure (PDB ID 3CDM), which has changes in the ε and ζ angles for the loop adenine res... due (Figure 3a ).

Dihedral angles are derived from loops from PDB structures 1KF1 ( 1 ), 2HRI (2 and 3), 3CCO ( 4 ), 3CDM (5 and 6), 3CE5 ( 7 ), 3MIJ ( 8 ), 3QSC ( 9 ), 3SC8 (10 and 11) and 4DA3 ( 12 ).

This observation would be expected to have important consequences with respect to the rational design of small molecules targeted towards HTQs, however, the almost paradoxical observation of both type-1 and non-type-1 loops within a single ligand-bound HTQ structure (e.g. PDB IDs 3CDM, 3CE5, 3SC8, 3UYH, 4DA3, 4DAQ) precludes a clear conclusion: small molecule compounds are able to elicit both dramatic and negligible effects on TTA loop geometry.

Sugar pucker distributions for each non-type-1 loop 2RHI 2* 2RHI 3 3CCO 4 3CDM 5 3CDM 6 3CE5 7 3MIJ 8 3QSC 9 3QSF 9 3SC8 10 3SC8 11 3UYH 10 3UYH 11 4DA3 10 4DA3 12 4DAQ 10 4DAQ 12 T C3’- endo C2’- endo C2’- endo C1’- endo C2’- endo C2’- endo C3’- exo C2’- endo C2’- endo C2’- endo C3’- endo C2’- endo O4’- endo C2’- endo C3’- exo C1’- exo C4’- exo T C1’- exo C1’- exo C2’- endo C2’- endo C3’- endo C2’- endo C3’- endo C2’- endo C2’- endo C3’- exo C2’- exo C2’- endo C3’- endo C2’- endo C2’- endo C2’- endo C2’- endo A C2’- endo O4’- endo C4’- exo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C1’- exo C4’- exo C1’- exo C2’- endo C1’- exo C1’- exo C1’- exo C1’- exo *Numbers below PDB codes denote loop type.

Pucker distributions for TTA/UUAs of all type-1 loops 1KF1-a 1KF1-b 1KF1-c 1K8P 3IBK 3CDM-a 3CDM-b 3CDM-c 3CDM-d 3CE5 3SC8 3UYH 3T5E-a T C1’- exo C1’- exo C1’- exo C1’- exo C1’- exo C1’- exo C4’- exo C1’- exo C1’- exo C1’- exo C1’- exo C1’- exo C2’- endo T C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo A C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C1’- exo C2’- endo C2’- endo C2’- endo C2’- endo 3T5E-b 3T5E-c 4DA3 4DAQ 3R6R-a 3R6R-b 3R6R-c 4FXM-a 4FXM-b 4FXM-c 4G0F-a 4G0F-b 4G0F-c T C1’- exo C2’- endo C1’- exo C1’- exo C1’- exo C1’- exo C4’- exo C2’- endo C1’- exo C1’- exo C2’- endo C2’- endo C2’- endo T C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo A C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C1’- exo C1’- exo C2’- endo Yellow indicates a sugar which deviates from the consensus pucker conformation.

Publication Year: 2015