Citations in PubMed

Primary Citation PubMed: 17895279 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 6

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

Structure of two intramolecular G-quadruplexes formed by natural human telomere sequences in K+ solution.

(2007) Nucleic Acids Res 35

PubMed: 17895279 | PubMedCentral: PMC2095816 | DOI: 10.1093/nar/gkm706

Accession Nos PDB2JSK 2JSL 2JSM 2JSQ INTRODUCTION Guanine-rich DNA sequences can form G-quadruplex structures in vitro through stacking of planar G·G·G·G tetrads ( 1–5 ... .

Data deposition The coordinates for four quadruplex structures formed by the 23-nt and 25-nt natural and Br G-substituted human telomere sequences have been deposited in the Protein Data Bank (accession codes natural-Form 1: 2JSM ; Br G16-Form 1: 2JSK ; natural-Form 2: 2JSL ; Br G15-Form 2: 2JSQ ).

Publication Year: 2007


Applications of isothermal titration calorimetry in biophysical studies of G-quadruplexes.

(2009) Int J Mol Sci 10

PubMed: 19742177 | PubMedCentral: PMC2738904 | DOI: 10.3390/ijms10072935

(d) NMR structure of the G-quadruplex formed by the d[TAG 3 (T 2 AG 3 ) 3 TT] sequence (hybrid -2) in K+ solution (pdb code: 2JSL).

Publication Year: 2009


Molecular models for intrastrand DNA G-quadruplexes.

(2009) BMC Struct Biol 9

PubMed: 19811654 | PubMedCentral: PMC2768733 | DOI: 10.1186/1472-6807-9-64

143D , 186D , 1KF1 , 1XAV , 230D , 2F8U , 2GKU , 2HY9 , 2JPZ , 2JSL , 2JSM , 2O3M , 201D , 3CDM ), including 230D which contains the nucleotides uridine and inosine-phosphate.

1KF1 , 2GKU , 2HY9 , 2JPZ , 2JSL , 2JSM and 3CDM all contain the core sequence GGGTTAGGGTTAGGGTTAGGG and adopt three different topologies: namely -p-p-p, -l-l-p, -p-l-l.

Publication Year: 2009


Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

(2013) PLoS One 8

PubMed: 24367632 | PubMedCentral: PMC3867476 | DOI: 10.1371/journal.pone.0084113

In order to select the mixed model to use as starting point for our calculations, we evaluated the energetic stability of globally 80 receptor structures, since we included both original and optimized... experimentally determined conformations of 2HY9 (10 original structures + 10 energy optimized structures), 2JPZ (10 original structures + 10 energy optimized structures), 2JSL (10 original structures + 10 energy optimized structures) and 2JSM (10 original structures + 10 energy optimized structures) NMR models.

Molecular modeling analysis The PDB X-ray structure 1KF1 [ 9 ] and the NMR models 143D [ 7 ], 2HY9 [ 33 ], 2JPZ [ 34 ], 2JSL and 2JSM [ 12 ] related to the telomeric sequence d [AG 3 (T 2 AG 3 ) 3 ], were downloaded from the Protein Data Bank [ 35 ]; http://www.rcsb.org/pdb} to analyze the G-quadruplex structures in wt sequence.

Publication Year: 2013


PubMed ID is not available.

Published in 2014

PubMedCentral: PMC4032189

The calibration was done using previously reported NMR structures (PDB ID: 143D, 2GKU, 2HY9, 2JPZ, 2JSL, 2JSM, and 2KF8).

Publication Year: 2014


Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding.

(2014) Nucleic Acids Res 42

PubMed: 25428355 | PubMedCentral: PMC4267657 | DOI: 10.1093/nar/gku1245

Structures of ( a ) hybrid-1 (PDB ID: 2jsm ), and ( b ) hybrid-2 (PDB ID: 2jsl ) quadruplex topology with detailed view of the adenine bases located in the edgewise loops of both structures.

Publication Year: 2014