Citations in PubMed

Primary Citation PubMed: 16866556 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 12

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

Structural polymorphism of intramolecular quadruplex of human telomeric DNA: effect of cations, quadruplex-binding drugs and flanking sequences.

(2008) Nucleic Acids Res 36

PubMed: 18535007 | PubMedCentral: PMC2475613 | DOI: 10.1093/nar/gkn351

Average distances (in angstroms) from the C1′ of the G22 to the sugars of the guanines in the core for three different conformations of the G-quadruplex; open diamonds—(3+1) type 1, PD... ID 2GKU ( 18 ); black squares—propeller, PDB ID 1KF1 ( 24 ); black circles—basket PDB ID 143D ( 16 ).

Publication Year: 2008


Kinetics and mechanism of K+- and Na+-induced folding of models of human telomeric DNA into G-quadruplex structures.

(2008) Nucleic Acids Res 36

PubMed: 18567908 | PubMedCentral: PMC2475619 | DOI: 10.1093/nar/gkn379

Cartoon showing the folding topology of ODN1 in Na + [G 3 (T 2 AG 3 ) 3 , PDB id 143D, ( A )] and ODN1 [T 2 G 3 (T 2 AG 3 ) 3 A, PDB id 2GKU] in K + ( B ).

The figures were drawn using the molecular graphics program Chimera ( 65 ) from NMR-derived coordinates for the first conformer listed in pdb files 143D ( 24 ) and 2GKU ( 28 ).

Publication Year: 2008


Stability and kinetics of G-quadruplex structures.

(2008) Nucleic Acids Res 36

PubMed: 18718931 | PubMedCentral: PMC2553573 | DOI: 10.1093/nar/gkn517

Loop distances as defined by O3′-O5′ distances a PDB Code Sequence Loop 1 Loop 2 Loop 3 143D dA(GGGTTA) 3 GGG ( 39 ) type: antiparallel basket 12.1 l 19.7 d 14.3 l 148D d(GGTTGGTGTGGTT... G) ( 36 ) type: antiparallel chair 12.3 l 13.8 l 12.0 l 1I34 dGGTTTTGGCAG GGTTTTGGT) ( 40 ) type: hybrid 19.0 d 11.3 r 20.4 d 1KF1 dA(GGGTTA) 3 GGG) ( 35 ) type: parallel 10.8 r 11.3 r 9.7 r 2HY9 dAAA(GGGTTA) 3 GGGAA ( 41 ) type: hybrid 11.1 r 16.2 l 11.5 l 2JPZ dTTA(GGGTTA) 3 GGGTT ( 42 ) type: hybrid 15.8 l 12.6 l 11.9 r 2F8U d(GGGCGCGGGA GGAATTGGGCGGG) ( 37 ) 15.8 l 12.8 l 6.0 r 2GKU d(TTA(GGGTTA) 3 GGGA) ( 38 ) type: hybrid 11.9 r 17.2 l 8.8 l a These are taken from the first structure in the PDB files for NMR structures, therefore are part of the ensemble of structures that satisfy the spatial constraints.

Publication Year: 2008


Molecular models for intrastrand DNA G-quadruplexes.

(2009) BMC Struct Biol 9

PubMed: 19811654 | PubMedCentral: PMC2768733 | DOI: 10.1186/1472-6807-9-64

143D , 186D , 1KF1 , 1XAV , 230D , 2F8U , 2GKU , 2HY9 , 2JPZ , 2JSL , 2JSM , 2O3M , 201D , 3CDM ), including 230D which contains the nucleotides uridine and inosine-phosphate.

1KF1 , 2GKU , 2HY9 , 2JPZ , 2JSL , 2JSM and 3CDM all contain the core sequence GGGTTAGGGTTAGGGTTAGGG and adopt three different topologies: namely -p-p-p, -l-l-p, -p-l-l.

Publication Year: 2009


Verification of specific G-quadruplex structure by using a novel cyanine dye supramolecular assembly: II. The binding characterization with specific intramolecular G-quadruplex and the recognizing mechanism.

(2010) Nucleic Acids Res 38

PubMed: 19933263 | PubMedCentral: PMC2817466 | DOI: 10.1093/nar/gkp1045

The structures of the bcl-2 2345 , H24 , c-kit1 and TBA G-quadruplex were obtained from the RCSB Protein Data Bank and the PDB IDs were 2F8U, 2GKU, 2O3M and 148D, respectively.

Publication Year: 2010


Explaining the varied glycosidic conformational, G-tract length and sequence preferences for anti-parallel G-quadruplexes.

(2011) Nucleic Acids Res 39

PubMed: 21296760 | PubMedCentral: PMC3105399 | DOI: 10.1093/nar/gkr031

The (3SAA + 1SSA) model was built from the human telomeric G-quadruplex 2GKU ( 34 ); AAA was built from the first three G-quartets of the NMR parallel structure 139D ( 35 ).

The 2GKU experimental structure is characterized by 12 representative solution structure models.

The SA-aaab was built from the first two quartets of the NMR solution structure of the human telomere G-quadruplex d(T 2 G 3 TTAG 3 TTAG 3 TTAG 3 A) [( 34 ); PDB: 2GKU, first frame].

Publication Year: 2011


Insight into G-DNA structural polymorphism and folding from sequence and loop connectivity through free energy analysis.

(2011) J Am Chem Soc 133

PubMed: 21761922 | PubMedCentral: PMC3168932 | DOI: 10.1021/ja107805r

Stems of the L n , L w , D , and P 3 a models share the same initial structure taken from the first model of the NMR structure 2GKU .

The T 2 - L n / L w / D / P 4 p models were built by removing the third loop residue from the TTA- L n / L w / D / P 4 p models, respectively; an additional T 2 - L w model (T 2 - L w -2) was built from the third loop of the 1HUT ( 64 ) structure with the 2GKU stem.

To circumvent this, the present single-loop L n , L w , D , and P 3 a models were all built from a common stem structure (from the NMR structure 2GKU ( 56 )).

To test this, we ran explicit MD simulations on a model built from the 2GKU stem structure with a left dT 3 propeller loop (Figure 1 b).

( 56 ) Methods Starting Structures All of the L n , L w , D , and P 3 a models were built from the NMR structure 2GKU ;( 56 ) the P 2 a models were built from the 1L34 structure;( 57 ) the P 4 a stems were built from the crystal structure 1JPQ with two loop K + ions removed from the initial structure;( 58 ) and the stem structures of the P 3 p / P 4 p models were obtained from the first three/four G-quartets of the 139D structure, respectively.

Potential Involvement of Multimeric G-Quadruplexes in Anti-parallel/Parallel Equilibrium To test the plausibility of the above hypothesis, 50 ns MD simulations followed by free energy analyses were carried out on the anti-parallel monomer ( 2GKU ), parallel monomer (1KF1), and parallel dimer (1KF1 dimer) with 5′-to-5′ arrangement obtained from the crystal structure of 1KF1.

The T 3 - L n / L w / D models were built by mutating the dA to dT from the TTA- L n / L w / D models; an additional T 3 - L w model (T 3 - L w -2) was built by connecting the loop of the 1A6H structure( 65 ) with the 2GKU stem.

The initial structures of TTA- L n , TTA- L w , and TTA- P 3 a were obtained by keeping the third, second, and first loop of 2GKU , respectively; TTA- D was built by connecting the diagonal TTA loop from 143D ( 62 ) with the 2GKU stem; the TTA- P 2 a / P 3 p / P 4 p / P 4 a models were built by connecting the first loop of the 2GKU structure with the appropriate stems as stated above.

Publication Year: 2011


Structural dynamics of possible late-stage intermediates in folding of quadruplex DNA studied by molecular simulations.

(2013) Nucleic Acids Res 41

PubMed: 23700306 | PubMedCentral: PMC3737530 | DOI: 10.1093/nar/gkt412

Six of them were taken from the Protein Data Bank (PDB): (i) the nuclear magnetic resonance (NMR) solution structure of d[T 2 (G 3 T 2 A) 3 G 3 A] (2GKU, first frame) ( 12 ), a 3+1 (hybrid) monomolecu... ar quadruplex with three tetrads; (ii) the X-ray structure of d[A(G 3 T 2 A) 3 G 3 ] (1KF1) ( 45 ) folded in a monomolecular parallel quadruplex with three tetrads; (iii) the X-ray structure of [d(G 4 T 4 G 4 )] 2 (1JPQ) ( 46 ) Oxytricha nova telomeric dimeric antiparallel quadruplex with four tetrads; (iv) the X-ray structure of [d(TG 4 T)] 4 (352D) ( 47 ), forming four consecutive parallel stranded guanine tetrads with thymidines unstructured and bulged into space (one disordered thymidine residue was modeled); (v) the structure of RNA parallel quadruplex [r(UG 4 U)] 4 (1J8G) ( 48 ), forming four G-tetrads complemented by uridines that are bulged out; and (vi) the X-ray structure of [d(G 4 )] 4 (3TVB) ( 49 ), forming a parallel stranded stem with the first tetrad all- syn .

Publication Year: 2013


Structural dynamics of human telomeric G-quadruplex loops studied by molecular dynamics simulations.

(2013) PLoS One 8

PubMed: 23951152 | PubMedCentral: PMC3738534 | DOI: 10.1371/journal.pone.0071380

PDB ID ions type force field time(ns) abbreviation 143D Na + parm99 1000 anti_99 2GKU K + parm99 1000 hybrid_99 143D Na + parmbsc0 1000 anti_bsc0 2GKU K + parmbsc0 1000 hybrid_bsc0 143D Na + parmbsc0 ... anti_stem a 2GKU K + parmbsc0 5 hybrid_stem a a In these two structures, loop bases are deleted and just G-quartets left.

Results In the present work, we chose anti-parallel structure (PDB code, 143D) and [3+1] hybrid structure (PDB code, 2GKU) for simulations ( Figure 1 ).

Publication Year: 2013


Atomistic picture for the folding pathway of a hybrid-1 type human telomeric DNA G-quadruplex.

(2014) PLoS Comput Biol 10

PubMed: 24722458 | PubMedCentral: PMC3983051 | DOI: 10.1371/journal.pcbi.1003562

Materials and Methods System preparation In the preparation of the simulation system, we solvated the PDB structure (2GKU) within a box of 6087 TIP3P water molecules and added 3 and 24 ions to achieve... charge neutral and an equivalent ion concentration of .

In this work we studied the folding process of a 24-nt human telomeric DNA sequence (PDB ID 2GKU) ( Figure S1 ) [33] with explicitly modeled solvents and ions using an advanced sampling technique and large-scale simulations.

Publication Year: 2014


PubMed ID is not available.

Published in 2014

PubMedCentral: PMC4032189

The calibration was done using previously reported NMR structures (PDB ID: 143D, 2GKU, 2HY9, 2JPZ, 2JSL, 2JSM, and 2KF8).

Publication Year: 2014


Native electrospray mass spectrometry of DNA G-quadruplexes in potassium solution.

(2014) J Am Soc Mass Spectrom 25

PubMed: 24781455 | PubMedCentral: PMC4055847 | DOI: 10.1007/s13361-014-0890-3

(d) NMR structure of the hybrid G-quadruplex form of d(TT(GGGTTA) 3 GGGA) in K + solution [ 15 ] (PDB ID: 2GKU).

Publication Year: 2014