Citations in PubMed

Primary Citation PubMed: 7819264 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 4

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

Structure of HinP1I endonuclease reveals a striking similarity to the monomeric restriction enzyme MspI.

(2005) Nucleic Acids Res 33

PubMed: 15805123 | PubMedCentral: PMC1074309 | DOI: 10.1093/nar/gki337

USA 2003 100 6410 6415 12750473 42 Ban C. Yang W. Structural basis for MutH activation in E.coli mismatch repair and relationship of MutH to restriction endonucleases EMBO J. 1998 17 1526 1534 9482749... Figures and Tables Figure 1 Dimeric form of endonucleases: ( A ) EcoRI–DNA complex (PDB 1CKQ), ( B ) EcoRV–DNA complex (PDB 1RVA), ( C ) BglI–DNA complex (PDB 1DMU).

Publication Year: 2005

An overview of the structures of protein-DNA complexes.

(2000) Genome Biol 1

PubMed: 11104519 | PubMedCentral: PMC138832 | DOI: 10.1186/gb-2000-1-1-reviews001

Endonuclease EcoRV family 1rva * A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT- 1rvb A,B Endonuclease EcoRV E. coli 2.1 ------AAAGATATCTTAAA---GATATCTT- 1rvc A,B Endonuclease EcoR... E. coli 2.1 ------AAAGATATCTTAAA---GATATCTT- 2rve A,B Endonuclease EcoRV E. coli 3.0 CGAGCTCGCGAGCTCGCGAGCTCGCGAGCTCG 4rve † A,B,C,G Endonuclease EcoRV E. coli 3.0 -------GGGATATCCCGG----GATATCCC- 1rve A,B Endonuclease EcoRV E. coli 2.5 ------AAAGATATCTTAAA----GATATCTT- 1rv5 A,B Endonuclease EcoRV E. coli 2.1 ------CGGGATATCCC CGG---GATATCCC- 1bgb A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT- 1bss A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT- 1bua A,B Endonuclease EcoRV E. coli 2.15 ------AAAGACATCTT--------------- 1bsu A,B Endonuclease EcoRV E. coli 2.0 ------AAAGACATCTT--------------- ** **** * 42.

Publication Year: 2000

Pushing the limits of what is achievable in protein-DNA docking: benchmarking HADDOCK's performance.

(2010) Nucleic Acids Res 38

PubMed: 20466807 | PubMedCentral: PMC2943626 | DOI: 10.1093/nar/gkq222

These, for instance, involve enzymes that perform their catalytic function on single nucleotides that are flipped out of the helix into a catalytic pocket of the protein (1emh, 7mht), restriction enzy... es clamping themselves around the DNA (3bam,1rva) or proteins with complex dimerization interfaces (1tro, 1f4k).

Publication Year: 2010

Re-visiting protein-centric two-tier classification of existing DNA-protein complexes.

(2012) BMC Bioinformatics 13

PubMed: 22800292 | PubMedCentral: PMC3472317 | DOI: 10.1186/1471-2105-13-165

Table 1 Representatives for previous families 54 existing families (Thornton classification) representatives were selected and were validated using Jack-knifing Group Families Representative(s) HTH &#... 000a0;     Cro & repressor 1LMB   Homeodomain 1FJL, 1HDD, 6PAX   LacI repressor 1WET   Endonuclease Fok1 1FOK   Gamma Delta resolvase 1GDT   Hin recombinase 1HCR   RAP1 family 1IGN   Prd paired domain 1PDN   Tc3 transposase 1TC3   Trp repressor 1TRR   Diptheria tox repressor 1DDN   Transcription factor IIB 1D3U   Interferon regulatory 2IRF   Catabolite gene activator protein 1RUO   Transcription factor 1CF7, 3HTS   Ets domain 1BC8 Zinc Co-ordinating       β-β-α zinc finger 1ZAA   Harmone Nuclear Receptor 2NLL   Loop sheet helix 1TSR   GAL4 type 1ZME Zipper type       Leucine Zipper 1YSA   Helix loop helix 1AN2 Other-α Helix       Pappilomavirus 1 E2 2BOP   Histone 1AOI   EBNA1 nuclear protein 1B3T   Skn-1 transcription factor 1SKN   Cre Recombinase 1CRX   High Mobility Group 1QRV   MADS box 1MNM β-Sheet       TATA box binding 1YTB β-Hairpin/Ribbon       MetJ repressor 1CMA   Tus replication terminator 1ECR   Integration host factor 1IHF   Transcription Factor T-domain 1XBR   Hyperthermophile DNA 1AZP   Arc repressor 1PAR Other       ReI homology 1SVC   Stat protein 1BF5 Enzyme       Methyltransferase 6MHT   Endonuclease PvuII 3PVI   Endonuclease ecorV 1RVA   Endonuclease ecorI 1QPS   Endonuclease BamHI 3BAM   Enonuclease V 1VAS   Dnase I 2DNJ   DNA mismatch endonuclease 1CW0   DNA polymerase β 1BPY   DNA Polymerase I 2BDP   DNA Polymerase T7 1T7P,1CLQ   HIV Reverse Transcriptase 2HMI   Uracil DNA glycosylase 1SSP   3-Methyladenine DNA glycosylase 1BNK   Homing endonuclease 1A73, 1BP7   TopoisomeraseI 1A31 For all the 59 selected representatives, PSI-BLAST profiles were again built against dummy database using the earlier profile creation parameters (as described in Methods).

Publication Year: 2012