Citations in PubMed

Primary Citation PubMed: 8535785 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 2

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

Docking study of HIV-1 reverse transcriptase with phytochemicals.

(2011) Bioinformation 5

PubMed: 21423889 | PubMedCentral: PMC3055157 | DOI: null

All the phytochemicals were used as ligand at mentioned 5 cavities of reverse transcriptase enzyme (PDB ID: 1REV) and the results of the top ligands whose rerank score > -100 were selected and... which were given in (a-e) (see Table 2 ) of the context along with the hydrogen bond interaction values, the hydrogen bond number and other electrostatic interaction values.

Supplementary material Data 1 Citation: Seal et al , Bioinformation 5(10): 430-439 (2011) References 1 Weiss RA Science 1993 260 5112 8493571 2 Douek DC Annu Rev Med 2009 60 471 18947296 3 De Clercq E Biochem Pharmacol 1994 47 155 7508227 4 De Clercq E Clin Microbiol Rev 1997 10 674 9336668 5 Goff SP J Acquired Immune Defic Syndr 1990 3 817 1694894 6 Mitsuya H Science 1990 249 4976 1699273 7 Asres K Phytother Res 2005 19 557 16161055 8 Kitamura K Antivir Res 1998 37 131 9588845 9 Zhou P Phytochemistry 2000 53 689 10746882 10 Cichewicz RH Kouzi SA MedRes Rev 2004 24 94 14595673 11 Holz-Smith SL Antimicrob Agents Chemother 2001 45 60 11120945 12 Loya S Biochem J 1999 344 85 10548537 13 Dey B J Virol 2000 74 4562 10775592 14 Uckun FM Antimicrob Agents Chemother 1998 42 383 9527790 15 Thomsen R Christensen MH J Med Chem 2006 49 3315 16722650 16 Wang R J Med Chem 2004 47 2977 15163179 17 Yang JM Chen CC Proteins 2004 55 288 15048822 18 Abad-Zapatero C Metz JT Drug Discov Today 2005 10 464 15809192 19 Sarafianos SG J Mol Biol 2009 385 693 19022262 20 Pauwels R Nature 1990 343 6257 1689015 Figure 1 Five cavities detected in reverse transcriptase enzyme (PDB ID: 1REV).

In this context groups of different set of phytochemicals were taken and docked into the different cavities of the Reverse transcriptase (PDB ID: 1REV) of Human immunodeficiency virus (HIV) and results were discussed.

Methodology The three dimensional structure of target HIV reverse transcriptase (PDBID: 1REV) was retrieved from protein data bank at 2.6 Å RMSD resolution.

Results and Discussion A total of five cavities ( Figure 1 ) were able to detected in reverse transcriptase enzyme (PDB ID: 1REV) by using Molegro Virtual Docker and were named cav1, cav2, cav3, cav4 and cav5, the volume and surface area details were given as (see Table 1 ).

Publication Year: 2011


miR-27 negatively regulates pluripotency-associated genes in human embryonal carcinoma cells.

(2014) PLoS One 9

PubMed: 25369332 | PubMedCentral: PMC4219743 | DOI: 10.1371/journal.pone.0111637

Primer Sequence Restriction site TGFßR1fwd atat GCGGCCGC CAGCTTTGCCTGAACTCTCC NotI TGFßR1rev atat CTCGAG ATGGGGAAACACAGCTTATG XhoI ACVR2Afwd atat CTCGAG ATTGATGGTAGGCAGGTGCT XhoI ACVR2... rev atat GAATTC GAATGAGACCATGGGGACAC EcoRI SMAD2-1fwd atat CTCGAG TTTATTGATGCCTGTTGTTTGC XhoI SMAD2-1rev atat GAATTC GAATGAGACCATGGGGACAC EcoRI SMAD2-2fwd atat CTCGAG ATGGCAAGTGAAGGAATTGG XhoI SMAD2-2rev atat GAATTC TGACCAGAAATCACAGGACAT EcoRI LIN28Bfwd atat CTCGAG GTTCTTTCCTTTACCCGGTTG XhoI LIN28Brev atat GAATTC TCCAATTATATGAGAGAGGGTGTG EcoRI NR5A2fwd atat AAGCTT TCTTCTAATTCAGATACTGGGGATTT HindIII NR5A2rev tata GAATTC TTATGCTCTTTTGGCATGCAACATT EcoRI POLR3Gfwd atat CTCGAG AACCACTTGAACCAGGCAAA HindIII POLR3Grev atat GAATTC TTGGAACAAACATCCCTGCT EcoRI NANOGfwd atat CTCGAG GGTCTTGGCTCACTGCAAG HindIII NANOGrev atat GAATTC TTGGAACAAACATCCCTGCT EcoRI OCT4fwd atat GCGGCCGC GTGCCTGCCCTTCTAGGAAT NotI OCT4rev atat CTCGAG TCTACTGTGTCCCAGGCTTCT XhoI SOX2fwd atat GCGGCCGC GGGGGAGAAATTTTCAAAGAA NotI SOX2rev atat CTCGAG TCTCAAACTGTGCATAATGGAGT XhoI Validation of miR-27 target genes was performed as previously described [16] .

Publication Year: 2014