Citations in PubMed

Primary Citation PubMed: 12050675 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 23

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

Not so crystal clear: the structure of the human telomere G-quadruplex in solution differs from that present in a crystal.

(2005) Nucleic Acids Res 33

PubMed: 16106044 | PubMedCentral: PMC1187823 | DOI: 10.1093/nar/gki782

Molecular dynamics simulations The d[AGGG(TTAGGG) 3 ] crystal structure (PDB code 1KF1) and NMR structure (143d) were used directly for molecular dynamics calculations.

Publication Year: 2005

Quadruplex DNA: sequence, topology and structure.

(2006) Nucleic Acids Res 34

PubMed: 17012276 | PubMedCentral: PMC1636468 | DOI: 10.1093/nar/gkl655

( b ) K + form A, determined by crystallography (PDB entry 1KF1) ( 23 ), with three strand-reversal loops ( c ) K + form B, showing the topology determined by NMR ( 75 , 96 ), with one strand-reversal... and two lateral loops.

Publication Year: 2006

Human telomere, oncogenic promoter and 5'-UTR G-quadruplexes: diverse higher order DNA and RNA targets for cancer therapeutics.

(2007) Nucleic Acids Res 35

PubMed: 17913750 | PubMedCentral: PMC2190718 | DOI: 10.1093/nar/gkm711

X-ray-based ( c ) folding topology and ( d ) crystal structure of the four-repeat human telomere unimolecular G-quadruplex formed by the d[AG 3 (T 2 AG 3 ) 3 ] sequence for crystals grown from K + sol... tion (coordinates deposition: 1KF1) ( 17 ).

Publication Year: 2007

Structural polymorphism of intramolecular quadruplex of human telomeric DNA: effect of cations, quadruplex-binding drugs and flanking sequences.

(2008) Nucleic Acids Res 36

PubMed: 18535007 | PubMedCentral: PMC2475613 | DOI: 10.1093/nar/gkn351

Average distances (in angstroms) from the C1′ of the G22 to the sugars of the guanines in the core for three different conformations of the G-quadruplex; open diamonds—(3+1) type 1, PD... ID 2GKU ( 18 ); black squares—propeller, PDB ID 1KF1 ( 24 ); black circles—basket PDB ID 143D ( 16 ).

Publication Year: 2008

Stability and kinetics of G-quadruplex structures.

(2008) Nucleic Acids Res 36

PubMed: 18718931 | PubMedCentral: PMC2553573 | DOI: 10.1093/nar/gkn517

Loop distances as defined by O3′-O5′ distances a PDB Code Sequence Loop 1 Loop 2 Loop 3 143D dA(GGGTTA) 3 GGG ( 39 ) type: antiparallel basket 12.1 l 19.7 d 14.3 l 148D d(GGTTGGTGTGGTT... G) ( 36 ) type: antiparallel chair 12.3 l 13.8 l 12.0 l 1I34 dGGTTTTGGCAG GGTTTTGGT) ( 40 ) type: hybrid 19.0 d 11.3 r 20.4 d 1KF1 dA(GGGTTA) 3 GGG) ( 35 ) type: parallel 10.8 r 11.3 r 9.7 r 2HY9 dAAA(GGGTTA) 3 GGGAA ( 41 ) type: hybrid 11.1 r 16.2 l 11.5 l 2JPZ dTTA(GGGTTA) 3 GGGTT ( 42 ) type: hybrid 15.8 l 12.6 l 11.9 r 2F8U d(GGGCGCGGGA GGAATTGGGCGGG) ( 37 ) 15.8 l 12.8 l 6.0 r 2GKU d(TTA(GGGTTA) 3 GGGA) ( 38 ) type: hybrid 11.9 r 17.2 l 8.8 l a These are taken from the first structure in the PDB files for NMR structures, therefore are part of the ensemble of structures that satisfy the spatial constraints.

Publication Year: 2008

Natural isoflavones regulate the quadruplex-duplex competition in human telomeric DNA.

(2009) Nucleic Acids Res 37

PubMed: 19261597 | PubMedCentral: PMC2677859 | DOI: 10.1093/nar/gkp055

3 Molecular modeling Three experimental structures are chosen as starting models, including the antiparallel basket-type NMR structure (PDB 143D), the parallel propeller-type X-ray structure (PDB 1KF1... , and the mixed hybrid-type NMR structure deduced from a 26-nt DNA sequence (PDB 2HY9) through removal of two terminal adenines from each end of the 26-nt sequence ( 42 , 43 ).

Therefore, three experimental structures are chosen as starting models in our simulations, including antiparallel basket-type G-quadruplex (PDB 143D), hybrid-type G-quadruplex (PDB 2HY9) and parallel propeller-type G-quadruplex (PDB 1KF1) separately ( 43 ).

Publication Year: 2009

Applications of isothermal titration calorimetry in biophysical studies of G-quadruplexes.

(2009) Int J Mol Sci 10

PubMed: 19742177 | PubMedCentral: PMC2738904 | DOI: 10.3390/ijms10072935

(b) Crystal structure of the parallel G-quadruplex formed by the d[AG 3 (T 2 AG 3 ) 3 ] sequence in the presence of K+ (pdb code:1KF1).

Publication Year: 2009

Molecular models for intrastrand DNA G-quadruplexes.

(2009) BMC Struct Biol 9

PubMed: 19811654 | PubMedCentral: PMC2768733 | DOI: 10.1186/1472-6807-9-64

1KF1 , 2GKU , 2HY9 , 2JPZ , 2JSL , 2JSM and 3CDM all contain the core sequence GGGTTAGGGTTAGGGTTAGGG and adopt three different topologies: namely -p-p-p, -l-l-p, -p-l-l.

143D , 186D , 1KF1 , 1XAV , 230D , 2F8U , 2GKU , 2HY9 , 2JPZ , 2JSL , 2JSM , 2O3M , 201D , 3CDM ), including 230D which contains the nucleotides uridine and inosine-phosphate.

Publication Year: 2009

A crystallographic and modelling study of a human telomeric RNA (TERRA) quadruplex.

(2010) Nucleic Acids Res 38

PubMed: 20413582 | PubMedCentral: PMC2938214 | DOI: 10.1093/nar/gkq259

Hydroxyl group interactions are linked to sugar pucker conformation, and appear to affect the hydration structure and overall stability of the RNA quadruplex The sugar pucker arrangement in our struct... re for the guanine G 3 stack has C2′- endo puckers at the ends and a C3′- endo for the central guanine, an arrangement consistent with the RNA quadruplex (PDB ID 2KBP) in NMR solution, but quite different from the two equivalent DNA quadruplex structures (PDB ID 1K8P and PDB ID 1KF1).

Publication Year: 2010

Insight into G-DNA structural polymorphism and folding from sequence and loop connectivity through free energy analysis.

(2011) J Am Chem Soc 133

PubMed: 21761922 | PubMedCentral: PMC3168932 | DOI: 10.1021/ja107805r

Considering the 1KF1 parallel dimer, the free energy gain upon association of the two parallel structures into a stacked dimer is ∼ –23.3 kcal/mol (neglecting rotational and tr... nslational entropy loss penalties, estimated from theory and experiment to be in the range of 3–10 kcal/mol, 82 − 87 implying more accurate association free energies in the −13 to −20 kcal/mol range), which still favors the anti-parallel structure.

Potential Involvement of Multimeric G-Quadruplexes in Anti-parallel/Parallel Equilibrium To test the plausibility of the above hypothesis, 50 ns MD simulations followed by free energy analyses were carried out on the anti-parallel monomer ( 2GKU ), parallel monomer (1KF1), and parallel dimer (1KF1 dimer) with 5′-to-5′ arrangement obtained from the crystal structure of 1KF1.

Publication Year: 2011

Discovery of a natural product-like c-myc G-quadruplex DNA groove-binder by molecular docking.

(2012) PLoS One 7

PubMed: 22912844 | PubMedCentral: PMC3422278 | DOI: 10.1371/journal.pone.0043278

We constructed a model of the intramolecular G-quadruplex loop isomer of NHE III 1 using the X-ray crystal structure of the intramolecular human telomeric G-quadruplex DNA (PDB code: 1KF1) [7] .

The initial model of loop isomer was built from the X-ray crystal structures of human intramolecular telomeric G quadruplex (PDB code: 1KF1) [7] , according to a previously reported procedure [9] , [10] .

Publication Year: 2012

Dioxaphosphorinane-constrained nucleic Acid dinucleotides as tools for structural tuning of nucleic acids.

(2012) J Nucleic Acids 2012

PubMed: 23150809 | PubMedCentral: PMC3488415 | DOI: 10.1155/2012/215876

PDB ID: Hairpin, 1ii1; duplex, 436d; Bulge, 1jrv; 4-Way junction, 1zez, and G-quad, 1kf1.

Publication Year: 2012

Aminoglycosylation can enhance the G-quadruplex binding activity of epigallocatechin.

(2013) PLoS One 8

PubMed: 23335983 | PubMedCentral: PMC3545880 | DOI: 10.1371/journal.pone.0053962

The X-ray crystal structure of the intramolecular G-quadruplex DNA was obtained from the Protein Data Bank (PDB code: 1KF1) and used as the model to perform molecular modeling [57] .

Molecular Modeling of Methylated EGC Glucosaminoside Derivatives Binding with Human Telomeric DNA G-quadruplex Using 16 as a model compound, a molecular modeling study was performed on its binding with intramolecular human telomeric G-quadruplex (PDB code: 1KF1 [52] ) to provide insight into the binding mode of aminoglucosides of methylated EGC.

g005 Figure 5 Molecular modeling of 16 binding with the human intramolecular telomeric G-quadruplex (PDB code: 1KF1).

Publication Year: 2013

Conformational dynamics of the human propeller telomeric DNA quadruplex on a microsecond time scale.

(2013) Nucleic Acids Res 41

PubMed: 23293000 | PubMedCentral: PMC3575793 | DOI: 10.1093/nar/gks1331

The 22-mer sequence, d[AG 3 (T 2 AG 3 ) 3 ] adopts a distinct topology in concentrated K + solution, as observed in the crystal structure (PDB id:1KF1) ( 10 ).

MATERIALS AND METHODS MD simulations The crystal structure of the parallel stranded propeller-type quadruplex formed from the human telomeric sequence d[AG 3 (T 2 AG 3 ) 3 ] (PDB id:1KF1) was used as the starting structure for the simulation ( 10 ).

The mobility distribution was calculated using B-factors from the crystal structure (PDB id 1KF1) and averaged RMSF from the MD simulation.

Publication Year: 2013

Structural and mechanical properties of individual human telomeric G-quadruplexes in molecularly crowded solutions.

(2013) Nucleic Acids Res 41

PubMed: 23396442 | PubMedCentral: PMC3616730 | DOI: 10.1093/nar/gkt038

With this assignment, the RMSD was calculated ( Figure 3 A, bottom panel), which indicates the ∼2.0 nm species as the parallel G-quadruplex (PDB: 1KF1 and 2LD8 in Figure 3 B and Supplementary ... igure S2 ) and the ∼3.8 nm population as the hybrid 1 G-quadruplex (PDB code: 2HY9, Figure 3 B and Supplementary Figure S2 ).

Publication Year: 2013

V-shaped dinuclear Pt(II) complexes: selective interaction with human telomeric G-quadruplex and significant inhibition towards telomerase.

(2013) Sci Rep 3

PubMed: 23792883 | PubMedCentral: PMC3690394 | DOI: 10.1038/srep02060

(a) a G-tetrad consists of four guanines, (b) the wild-type 22-mer crystal with K + (parallel structure, PDB ID: 1KF1), (c) the modified 20-mer in K + solution (mixed-type “(3 + 1) hybrid... 1d; structure, PDB ID: 2KZD), (d) the wild-type 22-mer in Na + solution (basket-type “(2 + 2) hybrid” structure, PDB ID: 143D).

Publication Year: 2013

Structural dynamics of possible late-stage intermediates in folding of quadruplex DNA studied by molecular simulations.

(2013) Nucleic Acids Res 41

PubMed: 23700306 | PubMedCentral: PMC3737530 | DOI: 10.1093/nar/gkt412

Six of them were taken from the Protein Data Bank (PDB): (i) the nuclear magnetic resonance (NMR) solution structure of d[T 2 (G 3 T 2 A) 3 G 3 A] (2GKU, first frame) ( 12 ), a 3+1 (hybrid) monomolecu... ar quadruplex with three tetrads; (ii) the X-ray structure of d[A(G 3 T 2 A) 3 G 3 ] (1KF1) ( 45 ) folded in a monomolecular parallel quadruplex with three tetrads; (iii) the X-ray structure of [d(G 4 T 4 G 4 )] 2 (1JPQ) ( 46 ) Oxytricha nova telomeric dimeric antiparallel quadruplex with four tetrads; (iv) the X-ray structure of [d(TG 4 T)] 4 (352D) ( 47 ), forming four consecutive parallel stranded guanine tetrads with thymidines unstructured and bulged into space (one disordered thymidine residue was modeled); (v) the structure of RNA parallel quadruplex [r(UG 4 U)] 4 (1J8G) ( 48 ), forming four G-tetrads complemented by uridines that are bulged out; and (vi) the X-ray structure of [d(G 4 )] 4 (3TVB) ( 49 ), forming a parallel stranded stem with the first tetrad all- syn .

Publication Year: 2013

Polyethylene glycol binding alters human telomere G-quadruplex structure by conformational selection.

(2013) Nucleic Acids Res 41

PubMed: 23804761 | PubMedCentral: PMC3763525 | DOI: 10.1093/nar/gkt440

Four PEG 200 or 600 molecules were manually docked to the groove regions of 1KF1 and in two separate systems to the groove regions and quartet backbone of 2HY9-t.

The 50% (v/v) acetonitrile system was investigated using the propeller form of the human telomere (PDB entry 1KF1) with 4199 acetonitrile and 8398 TIP3P water molecules using periodic box conditions.

Molecular modeling The propeller form of the human telomere (PDB entry 1KF1) and hybrid 1 form (PDB entry 2HY9) were used to examine PEG 200 and 600 binding.

Publication Year: 2013

Conformation and stability of intramolecular telomeric G-quadruplexes: sequence effects in the loops.

(2013) PLoS One 8

PubMed: 24367632 | PubMedCentral: PMC3867476 | DOI: 10.1371/journal.pone.0084113

Molecular modeling analysis The PDB X-ray structure 1KF1 [ 9 ] and the NMR models 143D [ 7 ], 2HY9 [ 33 ], 2JPZ [ 34 ], 2JSL and 2JSM [ 12 ] related to the telomeric sequence d [AG 3 (T 2 AG 3 ) 3 ], ... ere downloaded from the Protein Data Bank [ 35 ];} to analyze the G-quadruplex structures in wt sequence.

Publication Year: 2013

Native electrospray mass spectrometry of DNA G-quadruplexes in potassium solution.

(2014) J Am Soc Mass Spectrom 25

PubMed: 24781455 | PubMedCentral: PMC4055847 | DOI: 10.1007/s13361-014-0890-3

(b) X-ray crystal structure of the parallel G-quadruplex form of d(A(GGGTTA) 3 GGG) in K + conditions [ 12 ] (PDB ID: 1KF1).

Publication Year: 2014

PubMed ID is not available.

Published in 2015

PubMedCentral: PMC4446451

Pucker distributions for TTA/UUAs of all type-1 loops 1KF1-a 1KF1-b 1KF1-c 1K8P 3IBK 3CDM-a 3CDM-b 3CDM-c 3CDM-d 3CE5 3SC8 3UYH 3T5E-a T C1’- exo C1’- exo C1’- exo C1’-... exo C1’- exo C1’- exo C4’- exo C1’- exo C1’- exo C1’- exo C1’- exo C1’- exo C2’- endo T C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo A C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C1’- exo C2’- endo C2’- endo C2’- endo C2’- endo 3T5E-b 3T5E-c 4DA3 4DAQ 3R6R-a 3R6R-b 3R6R-c 4FXM-a 4FXM-b 4FXM-c 4G0F-a 4G0F-b 4G0F-c T C1’- exo C2’- endo C1’- exo C1’- exo C1’- exo C1’- exo C4’- exo C2’- endo C1’- exo C1’- exo C2’- endo C2’- endo C2’- endo T C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo C3’- endo A C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C2’- endo C1’- exo C1’- exo C2’- endo Yellow indicates a sugar which deviates from the consensus pucker conformation.

A structural alignment of the crystal and NMR structures, 1KF1 with 2LD8, (excluding the 5′ flanking residues) gives an average RMSD of 1.981 Å (see Supplementary Table S2)—this is an excellent correlation between solution and solid state.

The overall visual alignment of these two structures (1KF1 and 2LD8) may be observed by scrolling through the NMR ensemble and crystal structures and is very close.

Qualitative TTA/UUA loop descriptors in terms of base stacking Loop type Stacked bases Mutually perpendicular bases Orientation of 3 rd base 1 T1, A3 T2, A3 T2 close to A3 2 T1, T2 - A3 away from T1, T2 3 T2, A3 T1, A3 T1 close to A3 4 - T2, A3 T1 away from T2, A3 5 T2, A3 - T1 close to T2, A3 6 T2, A3 T1 T1 away from T2, A3 7 T2, A3 T1 close to T2 8 U2, A3 U1 U1 away from U2, A3 9 No stacking - All away from each other 10 T2, A3 - T1 away from T2, A3 11 No stacking T1, T2 A3 close to T1 12 T2, A3 - T1 away from T2, A3 Type-1 propeller loops By far the most commonly observed loop type is the intercalated ‘TAT’ loop found in the native telomeric DNA structures (PDB IDs 1KF1 and 1K8P), termed type-1 loops.

Sub-type 1 (left) is from PDB structure 1KF1, sub-type 2 (right) is from PDB structure 3T5E.

These are shown of the three type-1 propeller loops of the native human telomeric unimolecular quadruplex (PDB ID 1KF1) (each loop coloured separately; red, green or blue).

Structural alignment of the three stacked G-quartets of all HTQ crystal structures analysed in this work using the native HTQ structure (PDB ID 1KF1) as a reference gives an average r.m.s.d of just 0.86 Å (see Supplementary Table S1 and Figure S1).

(ii) An example of the structural diversity of non-type-1 loops: overlay of a type-4 loop (pink, from PDB structure 3CCO), a type-10 loop (green, from PDB structure 3SC8) and a type-1 loop (red, from PDB structure 1KF1).

Dihedral angles are derived from loops from PDB structures 1KF1 ( 1 ), 2HRI (2 and 3), 3CCO ( 4 ), 3CDM (5 and 6), 3CE5 ( 7 ), 3MIJ ( 8 ), 3QSC ( 9 ), 3SC8 (10 and 11) and 4DA3 ( 12 ).

For example, the native 22-mer structure (PDB ID 1KF1) and the naphthalene diimide derivative-complexed 22-mer (PDB ID 3T5E, with identical sequence) both contain three type-1 loops, which display a significant level of intramolecular correlation when comparing backbone dihedrals (Figure 3b , c , respectively).

Publication Year: 2015

PubMed ID is not available.

Published in 2015

PubMedCentral: PMC4446453

Structures shown here correspond to PDB entries: 1KF1, 3QSC, 3UYH, 3CE5, 3CCO, 2HRI, 4DA3, 4FXM, 3MIJ (from top left to bottom right).

Publication Year: 2015

PubMed ID is not available.

Published in 2015

PubMedCentral: PMC4551928

The highest deviations with respect to the initial configuration are obtained for the two parallel structures 1KF1 ↑↑ and RNA ↑↑ (see also Supplementary Figure S3 where... one graphical example of the conformations at the end of the equilibrium simulations has been presented).

The items used are the following: the parallel intramolecular DNA with PDB id:1KF1 ( 12 ) (obtained by X-ray diffraction); the hybrid intramolecular DNA with PDB id:2HY9 ( 17 ) (obtained by NMR) and the antiparallel intramolecular DNA with PDB id:143D ( 13 ) (obtained by NMR).

Top: All atom representation of the PDB files: 1KF1 ↑↑- parallel DNA, 2HY9 ↑↑↓ - hybrid I, 143D ↑↓ - antiparallel DNA.

Publication Year: 2015