Citations in PubMed

Primary Citation PubMed: 9201965 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 1

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

miR-27 negatively regulates pluripotency-associated genes in human embryonal carcinoma cells.

(2014) PLoS One 9

PubMed: 25369332 | PubMedCentral: PMC4219743 | DOI: 10.1371/journal.pone.0111637

Primer Sequence Restriction site TGFßR1fwd atat GCGGCCGC CAGCTTTGCCTGAACTCTCC NotI TGFßR1rev atat CTCGAG ATGGGGAAACACAGCTTATG XhoI ACVR2Afwd atat CTCGAG ATTGATGGTAGGCAGGTGCT XhoI ACVR2... rev atat GAATTC GAATGAGACCATGGGGACAC EcoRI SMAD2-1fwd atat CTCGAG TTTATTGATGCCTGTTGTTTGC XhoI SMAD2-1rev atat GAATTC GAATGAGACCATGGGGACAC EcoRI SMAD2-2fwd atat CTCGAG ATGGCAAGTGAAGGAATTGG XhoI SMAD2-2rev atat GAATTC TGACCAGAAATCACAGGACAT EcoRI LIN28Bfwd atat CTCGAG GTTCTTTCCTTTACCCGGTTG XhoI LIN28Brev atat GAATTC TCCAATTATATGAGAGAGGGTGTG EcoRI NR5A2fwd atat AAGCTT TCTTCTAATTCAGATACTGGGGATTT HindIII NR5A2rev tata GAATTC TTATGCTCTTTTGGCATGCAACATT EcoRI POLR3Gfwd atat CTCGAG AACCACTTGAACCAGGCAAA HindIII POLR3Grev atat GAATTC TTGGAACAAACATCCCTGCT EcoRI NANOGfwd atat CTCGAG GGTCTTGGCTCACTGCAAG HindIII NANOGrev atat GAATTC TTGGAACAAACATCCCTGCT EcoRI OCT4fwd atat GCGGCCGC GTGCCTGCCCTTCTAGGAAT NotI OCT4rev atat CTCGAG TCTACTGTGTCCCAGGCTTCT XhoI SOX2fwd atat GCGGCCGC GGGGGAGAAATTTTCAAAGAA NotI SOX2rev atat CTCGAG TCTCAAACTGTGCATAATGGAGT XhoI Validation of miR-27 target genes was performed as previously described [16] .

Publication Year: 2014