Citations in PubMed

Primary Citation PubMed: 1653449 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 13

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

An overview of the structures of protein-DNA complexes.

(2000) Genome Biol 1

PubMed: 11104519 | PubMedCentral: PMC138832 | DOI: 10.1186/gb-2000-1-1-reviews001

Catabolite gene activator protein family 2cgp * C Catabolite gene activator E. coli 2.2 -------------------------GTCACATTAAT-------------------- 1ber A,B Catabolite gene activator E. coli 2.5 --------... CGAAAAGTGTGACATATGTCACACTTTTCGGCGAAAAGTGTGACATATGTCACACTT 1cgp A,B Catabolite gene activator E. coli 3.0 ACTTTTCGGCGAAAAGTGTGACATATGTCACACTTTTCGGCGAAAAGTGTGACATAT--------- 1run A,B Catabolite gene activator E. coli 2.7 --------GCGAAAAATGTGATCTAGATCACATTTTTCGGCGAAAAATGTGATCTAGATCACATTT 1ruo A,B Catabolite gene activator E. coli 2.7 --------GCGAAAAATGTGATCTAGATCACATTTTTCGGCGAAAAATGTGATCTAGATCACATTT ******* ************ *********** ****** 15.

Publication Year: 2000


Structural insight into gene transcriptional regulation and effector binding by the Lrp/AsnC family.

(2006) Nucleic Acids Res 34

PubMed: 16528101 | PubMedCentral: PMC1401507 | DOI: 10.1093/nar/gkl009

Modelling of DNA interactions Modelling of the AsnC octamer bound to a curved piece of DNA (based on PDB code 1CGP) indicates that the pairs of DNA-binding N-terminal domains of individual dimers must... be reoriented relative to the effector-binding C-terminal domains to enable binding of an octamer simultaneously to multiple 13 bp sites with 18 bp spacings ( Figure 6a ).

Publication Year: 2006


Mechanistic insights from the crystal structures of a feast/famine regulatory protein from Mycobacterium tuberculosis H37Rv.

(2007) Nucleic Acids Res 35

PubMed: 17962306 | PubMedCentral: PMC2175373 | DOI: 10.1093/nar/gkm850

B-form DNA was taken from PDB 1CGP and adjusted using the program InsightII (M/s Accelrys) to fit the dimer.

Publication Year: 2007


A generalized allosteric mechanism for cis-regulated cyclic nucleotide binding domains.

(2008) PLoS Comput Biol 4

PubMed: 18404204 | PubMedCentral: PMC2275311 | DOI: 10.1371/journal.pcbi.1000056

Interface between two monomers of CAP is shown (PDB ID, 1CGP).

Publication Year: 2008


Prediction of TF target sites based on atomistic models of protein-DNA complexes.

(2008) BMC Bioinformatics 9

PubMed: 18922190 | PubMedCentral: PMC2585596 | DOI: 10.1186/1471-2105-9-436

The number of known sites extracted from RegulonDB [ 49 ] that constitute the sets of cognate sites is enclosed in parenthesis after the TF name followed by the PDB entry id enclosed in brackets: NarL... (73) [ 1je8 ], CRP (182) [ 1cgp ], PurR (15) [ 2pua ], and DnaA (8) [ 1j1v ].

The protein sequence of FNR can be confidently aligned to the sequence of E. coli CRP (PDB id : 1cgp ; alignment coverage = 71%) with TFmodeller [ 39 ], despite an overall sequence identity of just 22%, providing a reliable frame for comparative modeling.

Table 3 Comparison of cumulative contact and readout position weight matrices for 4 prokaryotic (top) and 4 eukaryotic (bottom) transcription factors SCOP v1.73 superfamily TF [PDB id ] Resolution (Å) R obs E -value contacts E -value readout Winged helix CRP [1cgp] 3 0.24 7.93E-03 3.76E-05 C-terminal domain of the bipartite response regulators NarL [1je8] 2.12 0.23 3.58E-05 7.01E-07 lambda repressor-like DNA-binding domains PurR [2pua] 2.9 0.16 4.33E-15 5.51E-01 (7.58E-04) ribbon-helix-helix MetJ [1cma] 2.8 0.22 1.22E-01 3.30E-01 Zn2/Cys6 DNA-binding domain LEU3 [2er8] 2.85 0.23 4.97E-06 5.52E-05 HLH, helix-loop-helix DNA-binding domain PHO4 [1a0a] 2.8 0.23 3.57E-07 3.97E-07 Homeodomain-like RAP1 [1ign] 2.25 0.21 5.52E-03 1.89E-02 (6.40E-04) C2H2 and C2HC zinc fingers ZIF268 [1aay] 1.6 0.19 7.93E-14 1.99E-14 In the first column we include the name of the structural superfamily of each TF according to SCOP [ 37 ].

The PDB identifiers are NarL [1je8], CRP [1cgp], PurR [2pua] and DnaA [1j1v].

Publication Year: 2008


Small local variations in B-form DNA lead to a large variety of global geometries which can accommodate most DNA-binding protein motifs.

(2009) BMC Struct Biol 9

PubMed: 19393049 | PubMedCentral: PMC2687451 | DOI: 10.1186/1472-6807-9-24

Cfit Lfit Cfit/Lfit Value Position 1KX5 30 15.1 10.5 51.9 A 10 A 11 A 12 126.7 0.77 37.9 0.6 20.0 0.03 C 0.1 1J59 28 25.3 16.2 66.5 T 9 G 10 A 11 98.5 0.85 47.2 0.7 21.4 0.03 C -41.9 1RUN 28 30.4 17.1... 71.1 T 9 G 10 A 11 109.7 0.85 47.8 0.6 22.2 0.03 C -50.6 1CGP 26 19.1 18.9 65.9 G 7 T 8 G 9 72.4 0.86 48.2 0.8 17.9 0.04 C -51.1 1BL0 20 10.5 6.1 25.0 A 6 G 7 C 8 38.8 0.94 47.0 0.7 3.6 0.19 C -68.9 1HLV 19 10.0 7.6 30.1 G 15 G 16 G 17 39.3 0.95 54.6 0.6 3.3 0.18 C -129.0 1APL 18 11.8 7.3 33.0 A 16 C 17 G 18 3.7 0.99 NA 4.9 0.9 5.44 L NA 1K78 23 9.1 3.2 15.6 T 19 G 20 G 21 15.9 1.00 NA 2.4 1.0 2.40 L NA 4CRX 32 11.8 12.2 56.5 A 17 T 18 G 19 76.3 0.82 NA 3.4 9.1 0.37 U NA 1GDT 32 15.4 13.0 60.3 T 14 T 15 A 16 40.2 0.87 NA 1.6 14.5 0.11 U NA 1MNM 23 11.8 7.8 26.8 G 13 A 14 A 15 58.7 0.89 NA 1.7 5.4 0.31 U NA 1JE8 18 23.0 13.0 49.6 T 2 A 3 C 4 56.9 0.93 NA 1.1 5.0 0.22 U NA 1DDN 23 8.8 4.4 19.1 T 13 T 14 A 15 36.0 0.95 NA 7.7 2.5 3.08 U NA 1L3L 18 9.0 5.9 19.7 C 14 A 15 C 16 32.5 0.96 NA 1.5 1.6 0.94 U NA 1U78 23 10.6 12.3 51.1 T 10 A 11 G 12 41.3 0.97 NA 1.4 19.6 0.07 U NA 1Z9C 24 10.0 5.9 23.9 T 11 A 12 T 13 3.4 0.97 NA 6.1 2.0 3.05 U NA 1H88 23 7.4 4.5 16.8 C 8 A 9 A 10 12.3 0.98 NA 1.6 7.8 0.21 U NA 1D5Y 18 8.9 5.7 21.6 C 15 A 16 A 17 10.6 0.98 NA 2.6 2.0 1.30 U NA 1K61 18 8.8 6.1 22.3 T 4 A 5 A 6 6.6 0.99 NA 1.3 7.1 0.18 U NA 1DU0 18 6.3 4.0 15.2 C 15 C 16 T 17 10.1 0.99 NA 0.6 2.9 0.21 U NA 1RIO 25 14.8 8.7 34.1 C 8 C 9 G 10 16.1 0.99 NA 0.6 2.7 0.22 U NA 6PAX 22 11.8 7.1 25.6 A 8 C 9 G 10 20.4 0.99 NA 0.6 2.1 0.29 U NA 2HDD 18 10.7 5.4 23.3 T 12 C 13 C 14 22.9 0.99 NA 1.2 1.8 0.67 U NA 1HDD 18 10.9 4.1 19.9 G 3 C 4 C 5 1.9 0.99 NA 2.6 1.4 1.86 U NA 3HDD 18 6.5 3.7 14.4 G 8 T 9 A 10 8.3 0.99 NA 3.0 1.4 2.14 U NA 1JT0 26 10.4 5.9 22.1 A 23 T 24 A 25 29.8 0.99 NA 9.1 1.1 8.27 U NA 1F4K 19 7.9 5.1 20.2 T 3 G 4 A 5 24.8 1.00 NA 0.8 2.4 0.33 U NA 1MDM 23 9.2 4.7 20.8 A 6 G 7 A 8 15.6 1.00 NA 1.7 1.1 1.55 U NA 1HF0 20 10.5 7.3 30.7 T 6 G 7 A 8 28.6 1.01 NA 1.4 0.9 1.56 U NA The calculation of successive bending angles, end-to-end bending angle, d/l local , Radius of Curvature (ROC), RMSD for circle fit (Cfit) and line fit (Lfit) and torsion angle for out-of-plane component of bending have been described in the 'Methods' section.

Of the structures where the DNA is curved, the CAP-DNA complexes (1CGP, 1J59, 1RUN), an ARAC family transcriptional activator-DNA complex (1BL0) and a CENP-B protein-DNA complex (1HLV), all consist of a dimeric protein that binds to two successive major grooves of the DNA, approximately one helix turn apart and the DNA is essentially curved due to two major in-phase kinks (additional file 4 , figure 1a ).

Publication Year: 2009


DNA-binding residues and binding mode prediction with binding-mechanism concerned models.

(2009) BMC Genomics 10 Suppl 3

PubMed: 19958487 | PubMedCentral: PMC2788376 | DOI: 10.1186/1471-2164-10-S3-S23

Table 5 Dataset of 253 TF-DNA complexes for DNA-binding residues prediction 253 TF-DNA Complexes 1A02:F 1A02:J 1A0A:A 1A0A:B 1A6Y:A 1A6Y:B 1AKH:A 1AKH:B 1AM9:A 1AM9:B 1AM9:C 1AM9:D 1AN2:A 1AN4:A 1AN4:... 1APL:C 1APL:D 1AU7:A 1AU7:B 1B01:A 1B01:B 1B72:B 1B8I:B 1BDT:A 1BDT:B 1BDT:C 1BDT:D 1BDV:A 1BDV:B 1BDV:C 1BDV:D 1BY4:A 1BY4:B 1BY4:C 1BY4:D 1C0W:A 1C0W:B 1C0W:C 1C0W:D 1CF7:A 1CF7:B 1CGP:A 1CGP:B 1CMA:A 1CMA:B 1CQT:A 1D5Y:A 1D5Y:B 1D5Y:C 1D5Y:D 1D66:A 1D66:B 1DDN:A 1DDN:B 1DDN:C 1DDN:D 1DSZ:A 1DSZ:B 1DU0:A 1DU0:B 1EA4:A 1EA4:B 1EA4:D 1EA4:E 1EA4:F 1EA4:G 1EA4:H 1EA4:J 1EA4:K 1EA4:L 1F2I:G 1F2I:H 1F2I:I 1F2I:J 1F2I:K 1F2I:L 1F5T:A 1F5T:B 1F5T:C 1F5T:D 1FJL:A 1FJL:B 1FJL:C 1FOS:E 1FOS:F 1FOS:G 1FOS:H 1G2D:C 1G2D:F 1G2F:C 1G2F:F 1GDT:A 1GDT:B 1H88:A 1H88:B 1H89:A 1H89:B 1H8A:A 1H8A:B 1H9T:A 1H9T:B 1HCQ:A 1HCQ:B 1HDD:C 1HDD:D 1HF0:A 1HF0:B 1HJB:A 1HJB:B 1HJB:D 1HJB:E 1HLO:A 1HLO:B 1HW2:A 1HW2:B 1HWT:C 1HWT:D 1HWT:G 1HWT:H 1IO4:A 1IO4:B 1JGG:A 1JGG:B 1JNM:A 1JNM:B 1JT0:A 1JT0:B 1JT0:C 1JT0:D 1JWL:A 1JWL:B 1K61:A 1K61:B 1K61:C 1K61:D 1KB2:A 1KB2:B 1KB4:A 1KB4:B 1KB6:A 1KB6:B 1KU7:A 1L3L:A 1L3L:B 1L3L:C 1L3L:D 1LAT:A 1LAT:B 1LB2:A 1LE8:A 1LE8:B 1LLI:A 1LLI:B 1LLM:C 1LMB:3 1LMB:4 1MDY:A 1MDY:C 1MDY:D 1MEY:C 1MEY:F 1MJM:A 1MJM:B 1MJP:A 1MJP:B 1MNM:C 1MNM:D 1NKP:A 1NKP:B 1NKP:D 1NKP:E 1NLW:A 1NLW:B 1NLW:D 1NLW:E 1P47:A 1P47:B 1PAR:A 1PAR:B 1PAR:C 1PAR:D 1PER:L 1PER:R 1PUF:A 1PUF:B 1PYI:A 1PYI:B 1QP9:A 1QP9:B 1QP9:C 1QP9:D 1R0N:A 1RPE:L 1RPE:R 1TF6:A 1TF6:D 1TRO:A 1TRO:C 1TRO:E 1TRO:G 1TRR:A 1TRR:B 1TRR:D 1TRR:E 1TRR:G 1TRR:H 1TRR:J 1TRR:K 1YRN:A 1YRN:B 1YSA:C 1YSA:D 1ZME:C 1ZME:D 2DRP:A 2DRP:D 2HAP:C 2HAP:D 2HDD:A 2HDD:B 2NLL:A 2NLL:B 2OR1:L 2OR1:R 2PRT:A 2QL2:A 2QL2:B 2QL2:C 2QL2:D 2R5Y:A 2R5Y:B 3BPY:A 3CBB:A 3CBB:B 3CO6:C 3COQ:A 3COQ:B 3D0A:A 3D0A:B 3D0A:C 3D0A:D 3DFX:A 3DFX:B 3DZY:A 3DZY:D 3E00:A 3E00:D 3EXJ:A 3EXJ:B 3EXL:A 3HDD:A 3HDD:B 9ANT:A Defining the DNA-binding residue Previous research used various distance cut-offs from 3.5 Å to 6 Å to define DNA-binding residues between proteins and DNA [ 6 - 10 , 14 , 40 , 42 ].

Publication Year: 2009


Enhanced expression of membrane proteins in E. coli with a P(BAD) promoter mutant: synergies with chaperone pathway engineering strategies.

(2011) Microb Cell Fact 10

PubMed: 22151946 | PubMedCentral: PMC3265434 | DOI: 10.1186/1475-2859-10-105

(B) Ribbon structure of CRP bound to its binding site rendered with Chimera using 1CGP coordinates [ 17 ].

Publication Year: 2011


Dynamic fluctuations provide the basis of a conformational switch mechanism in apo cyclic AMP receptor protein.

(2013) PLoS Comput Biol 9

PubMed: 23874183 | PubMedCentral: PMC3715548 | DOI: 10.1371/journal.pcbi.1003141

Additionally, the GNM analysis was also carried out for apo CRP NMR solution structures (PDB: 2WC2) [20] , holo CRP X-ray crystal structures with DNA (PDB: 1CGP) [21] and without DNA (PDB: 1G6N) [22] ... and for the two conformations from a previous MD simulation study of holo CRP (PDB: 1G6N) [18] , [22] .

The CRP structure in complex with DNA and cAMP (PDB: 1CGP).

Publication Year: 2013


Modulation of global low-frequency motions underlies allosteric regulation: demonstration in CRP/FNR family transcription factors.

(2013) PLoS Biol 11

PubMed: 24058293 | PubMedCentral: PMC3769225 | DOI: 10.1371/journal.pbio.1001651

PDB files for constructing CAP ENMs were 1CGP, 1G6N, 1HW5, 1I5Z, 1I6X, 1J59, 1O3T, 1RUN, 1RUO, 1ZRC, 1ZRD, 1ZRF, 2GZW, 4HZF (this work), and an additional in-house file isostructural to 2GZW.

Publication Year: 2013


PubMed ID is not available.

Published in 2015

PubMedCentral: PMC4526232

Projection of CAP X-ray structures and all simulation data from apo (black), cap1 (blue) and cap2 (orange) states on the first eigenvector obtained from a PCA of available 2 cAMP-bound X-ray structure... , either solved in absence of DNA (1–6: 1GN6 [ 9 ], 1HW5 [ 27 ], and 1I6X, 3RDI, 3ROU, 1I5Z –all unpublished) or in presence of DNA (9–11: 1RUO [ 28 ], 1RUN [ 28 ] and 1CGP [ 26 ]).

Publication Year: 2015


Cyclic nucleotide binding proteins in the Arabidopsis thaliana and Oryza sativa genomes.

(2005) BMC Bioinformatics 6

PubMed: 15644130 | PubMedCentral: PMC545951 | DOI: 10.1186/1471-2105-6-6

Theoretical model of atCNTE1 We generated a model of the atCNTE1 cyclic nucleotide binding domain (residues 28–117) based on an alignment of atCNTE1 with the CNB domains of RIIβ [pdb: ... CX4] [ 69 ], RIα [pdb: 1RGS] [ 70 ], CAP [pdb: 1CGP] [ 71 ], HCN2 [pdb: 1Q3E] [ 72 ] and Epac1 [pdb: 1O7F] [ 32 ].

Publication Year: 2005


Quantitative evaluation of protein-DNA interactions using an optimized knowledge-based potential.

(2005) Nucleic Acids Res 33

PubMed: 15673715 | PubMedCentral: PMC548349 | DOI: 10.1093/nar/gki204

Table 1 Data set of protein–DNA complexes Structural set (141 complexes) 1a02 1a0a 1a1g 1a1h 1a1k 1a3q 1akh 1am9 1an2 1an4 1apl 1au7 1b01 1b3t 1b72 1b8i 1bc8 1bdt 1bf5 1bl0 1by4 1c0w 1c9b 1cdw... 1cez 1cf7 1cgp 1cit 1d3u 1d5y 1ddn 1dh3 1du0 1dux 1e3o 1ea4 1efa 1egw 1f2i 1f5t 1fjl 1fos 1fzp 1g2f 1gd2 1gji 1gt0 1gu4 1gu5 1gxp 1h6f 1h8a 1h9d 1h9t 1hbx 1hcq 1hlo 1hlz 1hw2 1hwt 1ic8 1if1 1ig7 1ign 1imh 1io4 1j59 1je8 1jfi 1jgg 1jj4 1jk1 1jk2 1jnm 1jt0 1k6o 1k78 1k79 1k7a 1kb2 1kb4 1kb6 1ku7 1l3l 1lat 1lb2 1le5 1le9 1llm 1lmb 1lq1 1mdy 1mhd 1mjm 1mjo 1mm8 1mnm 1mnn 1mur 1n6j 1ngm 1nkp 1nvp 1nwq 1oct 1odh 1owf 1p47 1p7h 1pdn 1per 1pp7 1pp8 1pue 1puf 1pyi 1pzu 1r0o 1r4o 1r4r 1ram 1rio 1rpe 1run 1skn 1tf6 1tgh 1tsr 1ubd 1yrn 1ysa 1ytb 1ytf 2cgp 2drp 2gli 2hap 2hdd 2or1 6cro 6pax Table 2 Recognition accuracy for specific interactions between TFs and native bound DNA sequences Accuracy Top 1(%) Top 10(%) Top 20(%) Top 1(%) Top 5(%) Whole structural set 39.7 70.2 77.3 79.4 90.1 α-Helix a 26.3 54.4 63.2 66.7 82.5 α-Helix + β-strand a 49.4 79.2 85.7 87.0 94.8 a α-helix and β-strand refer to the secondary structures of DNA-binding sites.

Publication Year: 2005