Citations in PubMed

Primary Citation PubMed: 10074946 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 2

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

An overview of the structures of protein-DNA complexes.

(2000) Genome Biol 1

PubMed: 11104519 | PubMedCentral: PMC138832 | DOI: 10.1186/gb-2000-1-1-reviews001

Endonuclease EcoRV family 1rva * A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT- 1rvb A,B Endonuclease EcoRV E. coli 2.1 ------AAAGATATCTTAAA---GATATCTT- 1rvc A,B Endonuclease EcoR... E. coli 2.1 ------AAAGATATCTTAAA---GATATCTT- 2rve A,B Endonuclease EcoRV E. coli 3.0 CGAGCTCGCGAGCTCGCGAGCTCGCGAGCTCG 4rve † A,B,C,G Endonuclease EcoRV E. coli 3.0 -------GGGATATCCCGG----GATATCCC- 1rve A,B Endonuclease EcoRV E. coli 2.5 ------AAAGATATCTTAAA----GATATCTT- 1rv5 A,B Endonuclease EcoRV E. coli 2.1 ------CGGGATATCCC CGG---GATATCCC- 1bgb A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT- 1bss A,B Endonuclease EcoRV E. coli 2.0 ------AAAGATATCTTAAA---GATATCTT- 1bua A,B Endonuclease EcoRV E. coli 2.15 ------AAAGACATCTT--------------- 1bsu A,B Endonuclease EcoRV E. coli 2.0 ------AAAGACATCTT--------------- ** **** * 42.

Publication Year: 2000


Homology modelling of protein-protein complexes: a simple method and its possibilities and limitations.

(2008) BMC Bioinformatics 9

PubMed: 18844985 | PubMedCentral: PMC2586029 | DOI: 10.1186/1471-2105-9-427

Group A involves two structures of the endonuclease EcoRV, which is a homodimer, either bound to DNA (1BSU) or unbound (1RVE).

Publication Year: 2008