Citations in PubMed

Primary Citation PubMed: 9488644 Citations in PubMed

PDB ID Mentions in PubMed Central Article count: 6

Citations in PubMed

This linkout lists citations, indexed by PubMed, to the Primary Citation for this PDB ID.

PDB ID Mentions in PubMed Central

Data mentions are occurrences of PDB IDs in the full text articles from the PubMedCentral Open Access Subset of currently about 1 million articles. For each article, the sentences containing the PDB ID are listed. Article titles can be filtered by keywords and sorted by year.

  • 3 per page
  • 5 per page
  • 10 per page
  • view all
  • Publication Year
  • Ascending
  • Descending

Rotation of DNA around intact strand in human topoisomerase I implies distinct mechanisms for positive and negative supercoil relaxation.

(2005) Nucleic Acids Res 33

PubMed: 16314322 | PubMedCentral: PMC1298917 | DOI: 10.1093/nar/gki935

A covalent model of the DNA–topoisomerase complex was set-up, with the position of the linker domain (missing in the covalent structure, PDB code 1a31) built using the non-covalent structure (... DB code 1a36).

Publication Year: 2005


An overview of the structures of protein-DNA complexes.

(2000) Genome Biol 1

PubMed: 11104519 | PubMedCentral: PMC138832 | DOI: 10.1186/gb-2000-1-1-reviews001

Topoisomerase I 1a31 * A Topoisomerase I H. sapiens 2.1 AAAAAGACCCTGAAAAACCCCT 1a35 A Topoisomerase I H. sapiens 2.5 AAAAAGACCCTGAAAAACCCCT 1a36 A Topoisomerase I H. sapiens 2.8 AAAAAGACTTAGAAAAATTTTT... Each entry is provided with the four-digit PDB code, the name, the source, resolution and the aligned sequences of DNA to which the protein is bound in the crystal structure.

Publication Year: 2000


Insights into protein-DNA interactions through structure network analysis.

(2008) PLoS Comput Biol 4

PubMed: 18773096 | PubMedCentral: PMC2518215 | DOI: 10.1371/journal.pcbi.1000170

Class 1 Class 2 Class 3 Class 4 Class 5 Class 6 Class 7 P-p clusters only P-S clusters only P-B clusters only P-p and P-S clusters (no P-B clusters) P-S and P-B clusters (no P-p clusters) P-p and P-B ... lusters (no P-S clusters) P-p, P-S, and P-B clusters are present Overlapping clusters Non-overlapping clusters Overlapping clusters Non-overlapping clusters Overlapping clusters Non-overlapping clusters Overlapping P-p, P-B, and P-S clusters Non-overlapping P-p, P-B, and P-S clusters P-p and P-S clusters overlap but not P-B clusters P-S and P-B clusters overlap but not P-p clusters P-p and P-B clusters overlap but not P-S clusters P-P, P-B and P-S clusters occur separately β-Hairpin β-Hairpin Zinc coordinating group Enzymes β-Hairpin β-Hairpin Other α-helices Others Helix turn helix – β-Hairpin β-Sheet Enzymes β-Hairpin 1cma- a 1azp- 1zaa- 1a31- 1ecr- 1bnz- 1ckt- 1ramA 1apl- 1bdt- 1d3u- 1bss- 1ihf- a Enzymes 1bf4- 1a35- 1xbr- a β-Sheet 1vkx- 1lli- Enzymes 1tgh- 1ipp- β-Sheet 7ice- Enzymes 1bhm- a Enzymes 1c9bB Zipper type Others 1cyq- Enzymes Helix turn helix 1vol- Helix turn helix 2dnj- 1dnk- 1bnk- 1cdw- 1an4- 1a3qA 1dctA 2bdp- 1tc3- Enzymes 3orc- 2rve- 1t7pA 1bpx- Enzymes 1hlo- a 1bf5-* 1rv5- 3ktq- 1a74- a Other α-helices 3bam- 1qss- 10mh- 1nfkA 4skn- Helix turn helix 1ssp- 1skn- Helix turn helix 1qsy- 1clq- Zinc coordinating group 5mht- 1fjl- a 1vas- Zipper type 6pax- 2bpf- 1pvi- a 1a1g- Helix turn helix Zinc coordinating group 3pvi- 1ysa- a Other α-helices 2ktq- 1tau- 1aay-* 1gdt- a 1cit- Helix turn helix 1b3t- a 2ssp- 2pvi- 1d66-* 1ignA a 1fok- Zinc coordinating group 4ktq- Other α-helices 1ubd-* 1rpe- 1hcr- a 1lat- Helix turn helix 1qrv- 1zme- 6cro- 1mnm- a 1akh- Zipper type Zinc coordinating group 1yrn- a 1hddC a 1an2- 2gli- a 3cro- a 1pdn- Zipper type Zinc coordinating group 3hddA 1a02- 1a6y- Other α-helices 1a0a- 1aoi- Zinc coordinating group 1glu- 1tsr- a 2nll- a These protein–DNA complexes are also present in DS3 (see Materials and Methods section).

Publication Year: 2008


Evaluation of two models for human topoisomerase I interaction with dsDNA and camptothecin derivatives.

(2011) PLoS One 6

PubMed: 21912628 | PubMedCentral: PMC3166174 | DOI: 10.1371/journal.pone.0024314

pdb scissile strand base 11 is a guanine), and the base pairing non-scissile strand adenine in the 1A31.

pdb structure were deleted leaving the corresponding DNA from the 1A31.

Publication Year: 2011


Re-visiting protein-centric two-tier classification of existing DNA-protein complexes.

(2012) BMC Bioinformatics 13

PubMed: 22800292 | PubMedCentral: PMC3472317 | DOI: 10.1186/1471-2105-13-165

Table 1 Representatives for previous families 54 existing families (Thornton classification) representatives were selected and were validated using Jack-knifing Group Families Representative(s) HTH &#... 000a0;     Cro & repressor 1LMB   Homeodomain 1FJL, 1HDD, 6PAX   LacI repressor 1WET   Endonuclease Fok1 1FOK   Gamma Delta resolvase 1GDT   Hin recombinase 1HCR   RAP1 family 1IGN   Prd paired domain 1PDN   Tc3 transposase 1TC3   Trp repressor 1TRR   Diptheria tox repressor 1DDN   Transcription factor IIB 1D3U   Interferon regulatory 2IRF   Catabolite gene activator protein 1RUO   Transcription factor 1CF7, 3HTS   Ets domain 1BC8 Zinc Co-ordinating       β-β-α zinc finger 1ZAA   Harmone Nuclear Receptor 2NLL   Loop sheet helix 1TSR   GAL4 type 1ZME Zipper type       Leucine Zipper 1YSA   Helix loop helix 1AN2 Other-α Helix       Pappilomavirus 1 E2 2BOP   Histone 1AOI   EBNA1 nuclear protein 1B3T   Skn-1 transcription factor 1SKN   Cre Recombinase 1CRX   High Mobility Group 1QRV   MADS box 1MNM β-Sheet       TATA box binding 1YTB β-Hairpin/Ribbon       MetJ repressor 1CMA   Tus replication terminator 1ECR   Integration host factor 1IHF   Transcription Factor T-domain 1XBR   Hyperthermophile DNA 1AZP   Arc repressor 1PAR Other       ReI homology 1SVC   Stat protein 1BF5 Enzyme       Methyltransferase 6MHT   Endonuclease PvuII 3PVI   Endonuclease ecorV 1RVA   Endonuclease ecorI 1QPS   Endonuclease BamHI 3BAM   Enonuclease V 1VAS   Dnase I 2DNJ   DNA mismatch endonuclease 1CW0   DNA polymerase β 1BPY   DNA Polymerase I 2BDP   DNA Polymerase T7 1T7P,1CLQ   HIV Reverse Transcriptase 2HMI   Uracil DNA glycosylase 1SSP   3-Methyladenine DNA glycosylase 1BNK   Homing endonuclease 1A73, 1BP7   TopoisomeraseI 1A31 For all the 59 selected representatives, PSI-BLAST profiles were again built against dummy database using the earlier profile creation parameters (as described in Methods).

Publication Year: 2012


Sequence selectivity of the cleavage sites induced by topoisomerase I inhibitors: a molecular dynamics study.

(2013) Nucleic Acids Res 41

PubMed: 24021629 | PubMedCentral: PMC3905861 | DOI: 10.1093/nar/gkt791

This loop is known to have a direct impact on the flexibility of the linker domain ( 24 ), as the loop and the linker domain are also absent in the X-ray crystallographic structure of the Top1-DNA bin... ry complex (PDB: 1A31), but observable in the drug-bound ternary complexes (PDB: 1K4T) ( Supplementary Figure S3 ) ( 50 ).

Publication Year: 2013