NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.


NOTE: Use your mouse to access Jsmol features and to drag, rotate, and zoom in and out of the structure.Help





    Structure Details

    Select Options

    Surface options may take a long time to render, especially for larger structures

    Select a different viewer

    Help Links

    Jmol, an open source Java viewer for chemical structures in 3D (http://www.jmol.org)