Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid
DOI:10.2210/pdb2m90/pdb   NDB ID: 2M90
2M90
Primary Citation
 
 
  •   Molecular Description Hide
    Classification: DNA
    Structure Weight: 10118.60
    Molecule: 32-MER DNA
    Polymer: 1 Type: dna Length: 32
    Chains: A
     

  •   Related Citations in PDB Entry (REMARK 1) Hide
     
  •   Source Hide
    Polymer: 1
    Scientific Name: Synthetic construct   Taxonomy    
     
  •   Related PDB Entries Hide
    Identifier Details
    2M8Y   STRUCTURE OF D[CGCGAAGCATTCGCG] HAIRPIN (REFERENCE DUPLEX HAIRPIN) 
    2M8Z   STRUCTURE OF D[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex HYBRID (CONSTRUCT I) 
    2M91   STRUCTURE OF D[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex HYBRID (CONSTRUCT III) 
    2M92   STRUCTURE OF D[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex HYBRID (CONSTRUCT IV) 
    2M93   STRUCTURE OF D[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex HYBRID (CONSTRUCT V) 
     
  •   Structural Biology Knowledgebase Data Hide
     
  • Nucleic Acid Database Hide
    View the NDB ID associated with this structure:2M90
     
 
Data in orange boxes are gathered from external resources (when available).
Structure Image
Downloadable viewers: