2M8Z

Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid

Structural Biology Knowledgebase: 2M8Z SBKB.org


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 10
  • Selection Criteria: Structures with the Lowest Energy

Literature

Macromolecules
Sequence Display for 2M8Z

Classification: DNA

Total Structure Weight: 8445.47

Macromolecule Entities
Molecule Chains Length Organism Details
27-MER DNA A 27 synthetic


Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 10
  • Selection Criteria: structures with the lowest energy

Structure Validation

View Full Validation Report



Entry History

Deposition Data

  • Deposited Date: 2013-05-30
  • Released Date: 2013-07-10
  • Deposition author(s): Lim, K.W., Phan, A.T.

Revision History

No revisions since initial release