1KX3

X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution

Structural Biology Knowledgebase: 1KX3 SBKB.org


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.0 Å
  • R-Value Free: 0.275
  • R-Value Work: 0.240

wwPDB Validation Full Report


Literature

Macromolecules
Sequence Display for 1KX3

Classification: STRUCTURAL PROTEIN / DNA

Total Structure Weight: 199468.39


Macromolecule Entities
Molecule Chains Length Organism Details
histone H3 A, E 135 Xenopus laevis Mutation: G102A
histone H4 B, F 102 Xenopus laevis
histone H2A.1 C, G 128 Xenopus laevis Mutation: G99R, A123S, ΔA126
histone H2B.2 D, H 125 Xenopus laevis Mutation: S29T
Macromolecule Entities
Molecule Chains Length Organism Details
DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') I, J 146 Homo sapiens palindromic 146 base pair DNA duplex

Small Molecules
Ligands 1 Unique
ID Chains Name / Formula / InChI Key 2D Diagram 3D Interactions
MN
Query on MN

E, I, J MANGANESE (II) ION
Mn
WAEMQWOKJMHJLA-UHFFFAOYSA-N
Ligand Explorer
 
JSmol

Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.0 Å
  • R-Value Free: 0.275
  • R-Value Work: 0.240
  • Space Group: P 21 21 21

Unit Cell:

Length (Å) Angle (°)
a = 105.40 α = 90.00
b = 181.54 β = 90.00
c = 109.60 γ = 90.00

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History

Deposition Data

  • Deposited Date: 2002-01-31
  • Released Date: 2002-12-25
  • Deposition author(s): Davey, C.A., Sargent, D.F., Luger, K., Maeder, A.W., Richmond, T.J.

Revision History

  • 2011-07-13
    Type: Version format compliance | Details: compliance with PDB Exchange Dictionary V4