5T7B

Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.53 Å
  • R-Value Free: 0.238
  • R-Value Work: 0.193

Literature

Macromolecules
Sequence Display for 5T7B

Classification: HYDROLASE / RNA

Total Structure Weight: 104397.65


Macromolecule Entities
Molecule Chains Length Organism Details
Protein argonaute-2 A 861 Homo sapiens EC#: 3.1.26.n2 IUBMB
Mutation: D597N, D669N
Gene Name(s): AGO2 Gene View EIF2C2
Metabolic Pathways
Maps:       
Reactions:
ESCHER  BiGG
Macromolecule Entities
Molecule Chains Length Organism Details
RNA (UVP)UAUAGAGCAAGAACACUGUU R 21 Mus musculus

Small Molecules
Ligands 1 Unique
ID Chains Name / Formula / InChI Key 2D Diagram 3D Interactions
IPH
Query on IPH

A PHENOL
C6 H6 O
ISWSIDIOOBJBQZ-UHFFFAOYSA-N
Ligand Explorer NGL
 
Binding Pocket (JSmol)
 
Electron Density (JSmol)
Modified Residues 1 Unique
ID Chains Type Formula 2D Diagram Parent
UVP
Query on UVP
R NON-POLYMER C11 H16 N2 O8 P --

Experimental Data & Validation

Experimental Data

  • Method: X-RAY DIFFRACTION
  • Resolution: 2.53 Å
  • R-Value Free: 0.238
  • R-Value Work: 0.193
  • Space Group: P 1 21 1

Unit Cell:

Length (Å) Angle (°)
a = 63.21 α = 90.00
b = 108.31 β = 106.62
c = 68.82 γ = 90.00

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History

Deposition Data

  • Deposited Date: 2016-09-02
  • Released Date: 2016-12-14
  • Deposition author(s): Elkayam, E., Joshua-Tor, L.

Revision History

No revisions since initial release