5NW5

Crystal structure of the Rif1 N-terminal domain (RIF1-NTD) from Saccharomyces cerevisiae in complex with DNA


Experimental Data Snapshot

  • Method: X-RAY DIFFRACTION
  • Resolution: 6.5 Å
  • R-Value Free: 0.276
  • R-Value Work: 0.253

Literature

Macromolecules
Sequence Display for 5NW5

Classification: DNA BINDING PROTEIN

Total Structure Weight: 299995.19


Macromolecule Entities
Molecule Chains Length Organism Details
Telomere length regulator protein RIF1 A, B 1226 Saccharomyces cerevisiae Gene Name(s): RIF1 Gene View YBR275C YBR1743
Metabolic Pathways
Maps:       
Reactions:
ESCHER  BiGG
Macromolecule Entities
Molecule Chains Length Organism Details
DNA (60-MER) C 30 Synthetic construct Directionality and sequence register of the DNA could not be established unequivocally. DNA duplex modeled as poly-T in the most plausible orientation. Chain C construct sequence: ACGCTGCCGAATTCTACCAGTGCCTTGCTAGGACATCTTTGCCCACCTGCAGGTTCACCC.
DNA (30-MER) D 30 Synthetic construct Directionality and sequence register of the DNA could not be established unequivocally. DNA duplex modeled as poly-T in most plausible orientation. Chain D construct sequence: TAGCAAGGCACTGGTAGAATTCGGCAGCGT.


Experimental Data & Validation

Experimental Data

Unit Cell:

Length (Å) Angle (°)
a = 92.14 α = 90.00
b = 169.80 β = 90.00
c = 390.16 γ = 90.00

Structure Validation

View Full Validation Report



Entry History

Deposition Data

  • Deposited Date: 2017-05-05
  • Released Date: 2017-06-14
  • Deposition author(s): Bunker, R.D., Reinert, J.K., Shi, T., Thoma, N.H.

Revision History

  • 2017-06-28
    Type: Citation | Details: Citation