
DIY G-Quadruplexes: Solution Structure of d(GGGGTTTGGGGTTTTGGGGAAGGGG) in sodium

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 11
  • Selection Criteria: Structures with the Lowest Energy


Sequence Display for 5J6U

Classification: DNA

Total Structure Weight: 7978.10

Macromolecule Entities
Molecule Chains Length Organism Details
DNA (25-MER) A 25 Unidentified

Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 11
  • Selection Criteria: structures with the lowest energy

Structure Validation

View Full Validation Report or Ramachandran Plots

Entry History

Deposition Data

  • Deposited Date: 2016-04-05
  • Released Date: 2017-05-10
  • Deposition author(s): Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.

Revision History

  • 2017-08-30
    Type: Author supporting evidence, Derived calculations