5J05

DIY G-Quadruplexes: Solution structure of d(GGGTTTGGGTTTTGGGAGGG) in sodium


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 10
  • Selection Criteria: Structures with the Lowest Energy

Literature

Macromolecules
Sequence Display for 5J05

Classification: DNA

Total Structure Weight: 6348.07

Macromolecule Entities
Molecule Chains Length Organism Details
DNA (5'-D(*GP*GP*GP*TP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*AP*GP*GP*G)-3') A 20 Synthetic construct


Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 10
  • Selection Criteria: structures with the lowest energy

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History

Deposition Data

  • Deposited Date: 2016-03-27
  • Released Date: 2017-04-05
  • Deposition author(s): Dvorkin, S.A., Karsisiotis, A.I., Webba da Silva, M.

Revision History

  • Version 1_0: 2017-04-05

    Type: Initial release