Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid
DOI:10.2210/pdb2m8z/pdb   NDB ID: 2M8Z
2M8Z
Primary Citation
 
 
  •   Molecular Description Hide
    Classification: DNA
    Structure Weight: 8445.47
    Molecule: 27-MER DNA
    Polymer: 1 Type: dna Length: 27
    Chains: A
     

  •   Related Citations in PDB Entry (REMARK 1) Hide
     
  •   Source Hide
    Polymer: 1
    Scientific Name: Synthetic construct   Taxonomy    
     
  •   Related PDB Entries Hide
    Identifier Details
    2M8Y   STRUCTURE OF D[CGCGAAGCATTCGCG] HAIRPIN (REFERENCE DUPLEX HAIRPIN) 
    2M90   STRUCTURE OF D[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex HYBRID (CONSTRUCT II) 
    2M91   STRUCTURE OF D[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex HYBRID (CONSTRUCT III) 
    2M92   STRUCTURE OF D[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex HYBRID (CONSTRUCT IV) 
    2M93   STRUCTURE OF D[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex HYBRID (CONSTRUCT V) 
     
  •   Structural Biology Knowledgebase Data Hide
     
  • Nucleic Acid Database Hide
    View the NDB ID associated with this structure:2M8Z
     
 
Data in orange boxes are gathered from external resources (when available).
Structure Image
Downloadable viewers: