1OLD

NMR STRUCTURE OF 24-MER DEOXYRIBONUCLEIC ACID, 7 STRUCTURES

Structural Biology Knowledgebase: 1OLD SBKB.org


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: --
  • Conformers Submitted: 7
  • Selection Criteria:

Literature

Macromolecules
Sequence Display for 1OLD

Classification: DNA

Total Structure Weight: 7527.04

Macromolecule Entities
Molecule Chains Length Organism Details
DNA (GATCGAAACGTAGCGCCTTCGATC) A 24 synthetic

Small Molecules
Ligands 1 Unique
ID Chains Name / Formula / InChI Key 2D Diagram 3D Interactions
ARM
Query on ARM

A DEOXY-METHYL-ARGININE
C7 H16 N4 O
GCCQNSQKSSOQIR-LURJTMIESA-N
Ligand Explorer NGL
 
Binding Pocket (JSmol)
 
Electron Density (JSmol)

Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: --
  • Conformers Submitted: 7
  • Selection Criteria: --

Structure Validation

View Full Validation Report



Entry History

Deposition Data

  • Deposited Date: 1996-10-31
  • Released Date: 1997-04-21
  • Deposition author(s): Lin, C.H., Patel, D.J.

Revision History

  • 2011-07-13
    Type: Version format compliance | Details: compliance with PDB Exchange Dictionary V4