Macromolecule Annotations for the Entities in PDB 1KX5

Protein Family Annotation Pfam Database Homepage

Chains Pfam Accession Pfam Identifier Pfam Description Type Source
C PF00125 Histone Core histone H2A/H2B/H3/H4 Domain PFAM PF00125
D PF00125 Histone Core histone H2A/H2B/H3/H4 Domain PFAM PF00125
B PF15511 CENP-T Centromere kinetochore component CENP-T Family
A PF00125 Histone Core histone H2A/H2B/H3/H4 Domain PFAM PF00125

Gene Product Annotation Gene Ontology Consortium Homepage

Chains Polymer Molecular Function Biological Process Cellular Component
I DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') (1KX5:I)
  • none
  • none
  • none
J DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') (1KX5:J)
  • none
  • none
  • none
A,E histone H3 (1KX5:A,E)
  • none
B,F histone H4 (1KX5:B,F)
C,G histone H2A.1 (1KX5:C,G)
  • none
D,H histone H2B.2 (1KX5:D,H)
  • none