Macromolecule Annotations for the Entities in PDB 1KX4

Protein Family Annotation Pfam Database Homepage

Chains Pfam Accession Pfam Identifier Pfam Description Type Source
D PF00125 Histone Core histone H2A/H2B/H3/H4 Domain PFAM PF00125
C PF00125 Histone Core histone H2A/H2B/H3/H4 Domain PFAM PF00125
A PF00125 Histone Core histone H2A/H2B/H3/H4 Domain PFAM PF00125
B PF15511 CENP-T Centromere kinetochore component CENP-T Family

Gene Product Annotation Gene Ontology Consortium Homepage

Chains Polymer Molecular Function Biological Process Cellular Component
I,J DNA (5'(ATCTCCAAATATCCCTTGCGGATCGTAGAAAAAGTGTGTCAAACTGCGCTATCAAAGGGAAACTTCAACTGAATTCAGTTGAAGTTTCCCTTTGATAGCGCAGTTTGACACACTTTTTCTACGATCCGCAAGGGATATTTGGAGAT)3') (1KX4:I,J)
  • none
  • none
  • none
A,E histone H3 (1KX4:A,E)
  • none
B,F histone H4 (1KX4:B,F)
C,G histone H2A.1 (1KX4:C,G)
  • none
D,H histone H2B.2 (1KX4:D,H)
  • none

Protein Modification Annotation

Type PDB Residue Nr. Description