RCSB PDB

An Information Portal to 123021 Biological Macromolecular Structures

1KX3

X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution

Macromolecule Annotations for the Entities in PDB 1KX3

Domain Annotation: SCOP Classification SCOP Database (version: 1.75) Homepage

Chains	Domain Info	Class	Fold	Superfamily	Family	Domain	Species
A	d1kx3a_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H3	African clawed frog (Xenopus laevis) [TaxId: 8355]
B	d1kx3b_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H4	African clawed frog (Xenopus laevis) [TaxId: 8355]
C	d1kx3c_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2A	African clawed frog (Xenopus laevis) [TaxId: 8355]
D	d1kx3d_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2B	African clawed frog (Xenopus laevis) [TaxId: 8355]
E	d1kx3e_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H3	African clawed frog (Xenopus laevis) [TaxId: 8355]
F	d1kx3f_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H4	African clawed frog (Xenopus laevis) [TaxId: 8355]
G	d1kx3g_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2A	African clawed frog (Xenopus laevis) [TaxId: 8355]
H	d1kx3h_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2B	African clawed frog (Xenopus laevis) [TaxId: 8355]

Domain Annotation: CATH CATH Database (version 4.0.0) Homepage

Chains	Domain	Class	Architecture	Topology	Homology
A	1kx3A00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
B	1kx3B00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
C	1kx3C00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
D	1kx3D00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
E	1kx3E00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
F	1kx3F00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
G	1kx3G00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
H	1kx3H00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A

Protein Family Annotation Pfam Database Homepage

Chains	Pfam Accession	Pfam Identifier	Pfam Description	Type	Source
D	PF00125	Histone	Core histone H2A/H2B/H3/H4	Domain	PFAM PF00125
B	PF15511	CENP-T	Centromere kinetochore component CENP-T	Family
C	PF00125	Histone	Core histone H2A/H2B/H3/H4	Domain	PFAM PF00125
A	PF00125	Histone	Core histone H2A/H2B/H3/H4	Domain	PFAM PF00125

Gene Product Annotation Gene Ontology Consortium Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
I,J	DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') (1KX3:I,J)	none	none	none
A,E	histone H3 (1KX3:A,E)	DNA Binding Protein Heterodimerization Activity	none	Nucleosome Nucleus Nucleoplasm Chromosome
B,F	histone H4 (1KX3:B,F)	DNA Binding Protein Heterodimerization Activity	Nucleosome Assembly DNA Templated Transcription Initiation	Nucleosome Nucleus Chromosome
C,G	histone H2A.1 (1KX3:C,G)	DNA Binding Protein Heterodimerization Activity	none	Nucleosome Nucleus Chromosome
D,H	histone H2B.2 (1KX3:D,H)	DNA Binding Protein Heterodimerization Activity	none	Nucleosome Nucleus Chromosome

Protein Modification Annotation

Type	PDB Residue Nr.	Description

The RCSB PDB is funded by a grant (DBI-1338415) from the National Science Foundation, the National Institutes of Health, and the US Department of Energy.