RCSB PDB

141415 Biological Macromolecular Structures Enabling Breakthroughs in Research and Education

1KX3

X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution

Macromolecule Annotations for the Entities in PDB 1KX3

Domain Annotation: SCOP Classification SCOP Database (version: 1.75) Homepage

Chains	Domain Info	Class	Fold	Superfamily	Family	Domain	Species
A	d1kx3a_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H3	African clawed frog (Xenopus laevis) [TaxId: 8355]
B	d1kx3b_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H4	African clawed frog (Xenopus laevis) [TaxId: 8355]
C	d1kx3c_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2A	African clawed frog (Xenopus laevis) [TaxId: 8355]
D	d1kx3d_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2B	African clawed frog (Xenopus laevis) [TaxId: 8355]
E	d1kx3e_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H3	African clawed frog (Xenopus laevis) [TaxId: 8355]
F	d1kx3f_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H4	African clawed frog (Xenopus laevis) [TaxId: 8355]
G	d1kx3g_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2A	African clawed frog (Xenopus laevis) [TaxId: 8355]
H	d1kx3h_	All alpha proteins	Histone-fold	Histone-fold	Nucleosome core histones	Histone H2B	African clawed frog (Xenopus laevis) [TaxId: 8355]

Domain Annotation: CATH CATH Database (version 4.0.0) Homepage

Chains	Domain	Class	Architecture	Topology	Homology
A	1kx3A00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
B	1kx3B00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
C	1kx3C00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
D	1kx3D00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
E	1kx3E00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
F	1kx3F00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
G	1kx3G00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A
H	1kx3H00	Mainly Alpha	Orthogonal Bundle	Histone, subunit A	Histone, subunit A

Protein Family Annotation Pfam Database Homepage

Chains	Pfam Accession	Pfam Identifier	Pfam Description	Type	Source

Gene Product Annotation Gene Ontology Consortium Homepage

Chains	Polymer	Molecular Function	Biological Process	Cellular Component
I,J	DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') (1KX3:I,J)	none	none	none
A,E	histone H3 (1KX3:A,E)	DNA Binding Protein Binding Protein Heterodimerization Activity	none	Nucleosome Nucleus Nucleoplasm Chromosome
B,F	histone H4 (1KX3:B,F)	DNA Binding Protein Binding Protein Heterodimerization Activity	Nucleosome Assembly DNA Templated Transcription Initiation	Nucleosome Nucleus Chromosome
C,G	histone H2A.1 (1KX3:C,G)	DNA Binding Protein Heterodimerization Activity	none	Nucleosome Nucleus Chromosome
D,H	histone H2B.2 (1KX3:D,H)	DNA Binding Protein Binding Protein Heterodimerization Activity	none	Nucleosome Nucleus Chromosome

Protein Modification Annotation

Type	PDB Residue Nr.	Description

The RCSB PDB is funded by a grant (DBI-1338415) from the National Science Foundation, the National Institutes of Health, and the US Department of Energy.