An Information Portal to 108957 Biological Macromolecular Structures

Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid
Biology and Chemistry Report
  •   Structure Details   Hide

    Structure Keywords

    Keywords DNA
    Text quadruplex-duplex hybrid, duplex, quadruplex, DNA

    Polymeric Molecules

    Chain A
    Description 27-MER DNA 
    Nonstandard Linkage no 
    Nonstandard Monomers no 
    Polymer Type polydeoxyribonucleotide 
    Formula Weight 8445.5 
    Source Method synthetic  

  •   Protein Details   Hide

    UniProtKB Information

    Chain SWS/UNP ID SWS/UNP Accession(s)