POP-OUT | CLOSE
 
X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution
Biology and Chemistry Report
1KX5
  •   Structure Details   Hide

    Structure Keywords

    Keywords STRUCTURAL PROTEIN/DNA
    Text NUCLEOSOME, CHROMATIN, HISTONE, PROTEIN-DNA INTERACTION, NUCLEOPROTEIN, SUPERCOILED DNA, NUCLEOSOME CORE, PROTEIN-DNA COMPLEX, DNA BENDING, DNA CURVATURE, DNA-CATION BINDING, DNA-METAL BINDING, DNA SOLVATION, STRUCTURAL PROTEIN-DNA COMPLEX

    Polymeric Molecules

    Chain I
    Description DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') 
    Nonstandard Linkage no 
    Nonstandard Monomers no 
    Polymer Type polydeoxyribonucleotide 
    Formula Weight 45368.4 
    Source Method genetically manipulated  
    Chain J
    Description DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') 
    Nonstandard Linkage no 
    Nonstandard Monomers no 
    Polymer Type polydeoxyribonucleotide 
    Formula Weight 45359.4 
    Source Method genetically manipulated  
    Chain A,E
    Description histone H3 
    Nonstandard Linkage no 
    Nonstandard Monomers no 
    Polymer Type polypeptide(L) 
    Formula Weight 15304.1 
    Source Method genetically manipulated  
    Chain B,F
    Description histone H4 
    Nonstandard Linkage no 
    Nonstandard Monomers no 
    Polymer Type polypeptide(L) 
    Formula Weight 11263.3 
    Source Method genetically manipulated  
    Chain C,G
    Description histone H2A.1 
    Nonstandard Linkage no 
    Nonstandard Monomers no 
    Polymer Type polypeptide(L) 
    Formula Weight 13907.3 
    Source Method genetically manipulated  
    Chain D,H
    Description histone H2B.2 
    Nonstandard Linkage no 
    Nonstandard Monomers no 
    Polymer Type polypeptide(L) 
    Formula Weight 13848.2 
    Source Method genetically manipulated  

    Ligands and Prosthetic Groups

    ID Name Chemical Formula Weight Ligand Structure
    CL  CHLORIDE ION  Cl   35.45  View 
    MN  MANGANESE (II) ION  Mn   54.94  View 
     
  •   Protein Details   Hide

    UniProtKB Information

    Chain SWS/UNP ID SWS/UNP Accession(s)
    A,E H32_XENLA A4FVE2     
    B,F H4_XENLA P02304     
    C,G H2A1_XENLA P06897     
    D,H H2B11_XENLA P02281     

    Keywords and Names

    Chain(s) RCSB Name UniProtKB Name UniProtKB Keywords

    C: Cellular Location | F: Molecular Function | P: Biological Process
    Chain A,E
    GO ID   Ontology GO Term Definition
    786   Nucleosome  A Complex Comprised of DNA Wound Around a Multisubunit Core and Associated Proteins Which Forms the Primary Packing Unit of DNA Into Higher Order Structures. 
    5634   Nucleus  A Membrane Bounded Organelle of Eukaryotic Cells in Which Chromosomes Are Housed and Replicated. in Most Cells the Nucleus Contains All of the Cell's Chromosomes Except the Organellar Chromosomes and Is the Site of RNA Synthesis and Processing. in Some Species or in Specialized Cell Types RNA Metabolism or DNA Replication May Be Absent. 
    5694   Chromosome  A Structure Composed of a Very Long Molecule of DNA and Associated Proteins (e.g. Histones) That Carries Hereditary Information. 
    3677   DNA Binding  Any Molecular Function by Which a Gene Product Interacts Selectively and Non Covalently with DNA (deoxyribonucleic Acid). 
    5515   Protein Binding  Interacting Selectively and Non Covalently with Any Protein or Protein Complex (a Complex of Two or More Proteins That May Include Other Nonprotein Molecules). 
    Chain B,F
    GO ID   Ontology GO Term Definition
    786   Nucleosome  A Complex Comprised of DNA Wound Around a Multisubunit Core and Associated Proteins Which Forms the Primary Packing Unit of DNA Into Higher Order Structures. 
    5634   Nucleus  A Membrane Bounded Organelle of Eukaryotic Cells in Which Chromosomes Are Housed and Replicated. in Most Cells the Nucleus Contains All of the Cell's Chromosomes Except the Organellar Chromosomes and Is the Site of RNA Synthesis and Processing. in Some Species or in Specialized Cell Types RNA Metabolism or DNA Replication May Be Absent. 
    5694   Chromosome  A Structure Composed of a Very Long Molecule of DNA and Associated Proteins (e.g. Histones) That Carries Hereditary Information. 
    3677   DNA Binding  Any Molecular Function by Which a Gene Product Interacts Selectively and Non Covalently with DNA (deoxyribonucleic Acid). 
    5515   Protein Binding  Interacting Selectively and Non Covalently with Any Protein or Protein Complex (a Complex of Two or More Proteins That May Include Other Nonprotein Molecules). 
    Chain C,G
    GO ID   Ontology GO Term Definition
    786   Nucleosome  A Complex Comprised of DNA Wound Around a Multisubunit Core and Associated Proteins Which Forms the Primary Packing Unit of DNA Into Higher Order Structures. 
    5634   Nucleus  A Membrane Bounded Organelle of Eukaryotic Cells in Which Chromosomes Are Housed and Replicated. in Most Cells the Nucleus Contains All of the Cell's Chromosomes Except the Organellar Chromosomes and Is the Site of RNA Synthesis and Processing. in Some Species or in Specialized Cell Types RNA Metabolism or DNA Replication May Be Absent. 
    5694   Chromosome  A Structure Composed of a Very Long Molecule of DNA and Associated Proteins (e.g. Histones) That Carries Hereditary Information. 
    3677   DNA Binding  Any Molecular Function by Which a Gene Product Interacts Selectively and Non Covalently with DNA (deoxyribonucleic Acid). 
    Chain D,H
    GO ID   Ontology GO Term Definition
    786   Nucleosome  A Complex Comprised of DNA Wound Around a Multisubunit Core and Associated Proteins Which Forms the Primary Packing Unit of DNA Into Higher Order Structures. 
    5634   Nucleus  A Membrane Bounded Organelle of Eukaryotic Cells in Which Chromosomes Are Housed and Replicated. in Most Cells the Nucleus Contains All of the Cell's Chromosomes Except the Organellar Chromosomes and Is the Site of RNA Synthesis and Processing. in Some Species or in Specialized Cell Types RNA Metabolism or DNA Replication May Be Absent. 
    5694   Chromosome  A Structure Composed of a Very Long Molecule of DNA and Associated Proteins (e.g. Histones) That Carries Hereditary Information. 
    3677   DNA Binding  Any Molecular Function by Which a Gene Product Interacts Selectively and Non Covalently with DNA (deoxyribonucleic Acid). 


     
  •   Gene Details   Hide

    Genetic Source

    Chain D,H
    Common Name African Clawed Frog
    Scientific Name Xenopus laevis  
    Genus Xenopus
    Host Scientific Name Escherichia coli  
    Host Genus Escherichia


    Chain C,G
    Common Name African Clawed Frog
    Scientific Name Xenopus laevis  
    Genus Xenopus
    Host Scientific Name Escherichia coli  
    Host Genus Escherichia


    Chain B,F
    Common Name African Clawed Frog
    Scientific Name Xenopus laevis  
    Genus Xenopus
    Host Scientific Name Escherichia coli  
    Host Genus Escherichia


    Chain A,E
    Common Name African Clawed Frog
    Scientific Name Xenopus laevis  
    Genus Xenopus
    Host Scientific Name Escherichia coli  
    Host Genus Escherichia


    Chain J
    Common Name Human
    Scientific Name Homo sapiens  
    Genus Homo
    Host Scientific Name Escherichia coli  
    Host Genus Escherichia
    Description DNA Sequence Synthesized Cloned Multimerized and Excised From Plasmid


    Chain I
    Common Name Human
    Scientific Name Homo sapiens  
    Genus Homo
    Host Scientific Name Escherichia coli  
    Host Genus Escherichia
    Description DNA Sequence Synthesized Cloned Multimerized and Excised From Plasmid;


    Genome Information

    Chromosome Locus Gene ID Gene Name Symbol
    - - 734746     H2A histone family, member X H2AFX    
    - - 446588     histone cluster 1, H2bj HIST1H2BJ