2M6W

Solution NMR structure of the d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex in sodium conditions


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 8
  • Selection Criteria: Structures with the Lowest Energy

Literature

Macromolecules
Sequence Display for 2M6W

Classification: DNA

Total Structure Weight: 7673.97

Macromolecule Entities
Molecule Chains Length Organism Details
DNA (5'-D(*GP*GP*GP*GP*TP*TP*GP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*GP*AP*AP*GP*GP*GP*G)-3') A 24 synthetic


Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 8
  • Selection Criteria: structures with the lowest energy

Structure Validation

View Full Validation Report or Ramachandran Plots



Entry History

Deposition Data

  • Deposited Date: 2013-04-19
  • Released Date: 2014-07-23
  • Deposition author(s): Karsisiotis, A.I., Webba da Silva, M.

Revision History

  • 2014-10-22
    Type: Entry authorship | Details: --