NMR Ensemble

2M90

Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid

Structural Biology Knowledgebase: 2M90 SBKB.org


Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 10
  • Selection Criteria: Structures with the Lowest Energy

wwPDB Validation report is not available for this NMR entry.


Literature

Macromolecules
Sequence Display for 2M90

Classification: DNA

Total Structure Weight: 10118.60

Macromolecule Entities
Molecule Chains Length Organism Details
32-MER DNA A 32 synthetic


Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 100
  • Conformers Submitted: 10
  • Selection Criteria: structures with the lowest energy

Structure Validation

Validation report is not available for this NMR entry.



Entry History

Deposition Data

  • Deposited Date: 2013-05-30
  • Released Date: 2013-07-10
  • Deposition author(s): Lim, K.W., Phan, A.T.

Revision History

No revisions since initial release