POP-OUT | CLOSE
 
Structure of d[CGCGAAGCATTCGCG] hairpin
DOI:10.2210/pdb2m8y/pdb   NDB ID: 2M8Y
2M8Y
Primary Citation
 
 
  •   Molecular Description Hide
    Classification: DNA
    Structure Weight: 4595.02
    Molecule: DNA (5'-D(*CP*GP*CP*GP*AP*AP*GP*CP*AP*TP*TP*CP*GP*CP*G)-3')
    Polymer: 1 Type: dna Length: 15
    Chains: A
     

  •   Related Citations in PDB Entry (REMARK 1) Hide
     
  •   Source Hide
    Polymer: 1
    Scientific Name: Synthetic construct   Taxonomy    
     
  •   Related PDB Entries Hide
    Identifier Details
    2M8Z  STRUCTURE OF D[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex HYBRID (CONSTRUCT I) 
    2M90  STRUCTURE OF D[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex HYBRID (CONSTRUCT II) 
    2M91  STRUCTURE OF D[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex HYBRID (CONSTRUCT III) 
    2M92  STRUCTURE OF D[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex HYBRID (CONSTRUCT IV) 
    2M93  STRUCTURE OF D[TTGGGTGGGCGCGAAGCATTCGCGGGGTGGGT] quadruplex-duplex HYBRID (CONSTRUCT V) 
     
  •   Structural Biology Knowledgebase Data Hide
     
  • Nucleic Acid Database Hide
    View the NDB ID associated with this structure: 2M8Y
     
 
Data in orange boxes are gathered from external resources (when available).
 
Structure Image
Downloadable viewers: