NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12     DOI:10.2210/pdb1qwb/pdb   NDB ID: 1QWB

1QWB Display Files close FASTA Sequence PDB File PDB File (Header) mmCIF File mmCIF File (Header) PDBML/XML File PDBML/XML File (Header) Download Files close FASTA Sequence PDB File (Text) PDB File (gz) mmCIF File mmCIF File (gz) PDBML/XML File PDBML/XML File (gz) NMR Restraints (Text) NMR Restraints (gz) Print this Page Share this Page close Email Delicious Stumble Google More... Link this Page

Primary Citation       Molecular Description Hide Classification: RNA Structure Weight: 8366.12   Molecule: sNRE26 Polymer: 1 Type: polyribonucleotide Length: 26 Chains: A Other Details: RNA contains the consensus sequence for the in vitro selected NRE.       Source Hide Polymer: 1 Scientific Name: Synthetic construct         Related PDB Entries Hide Id Details 1IE1  NMR Solution Structure Of An In Vitro Selected RNA Which Is Sequence Specifically Recognized By Hamster Nucleolin Rbd12.  1IE2  Solution Structure Of An In Vitro Selected RNA Which Is Sequence Specifically Recognized By Rbd12 Of Hamster Nucleolin. Snre (Anti)  1QWA  NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.      Reset Layout

Structure Image More Images... View in Jmol Other Viewers close KiNG WebMol FirstGlance Kiosk SimpleViewer Protein Workshop Ligand Explorer         Deposition Summary Hide Authors:   Finger, L.D.,   Trantirek, L.,   Johansson, C.,   Feigon, J. Deposition:   2003-09-01 Release:   2003-11-25 Last Modified (REVDAT):   2009-02-24       Experimental Details Hide Method:   SOLUTION NMR Experimental Data:    [ NMR Restraint Grid ] NMR Ensemble Conformers Calculated:     17 Conformers Submitted:     17 Selection Criteria: all calculated structures submitted,structures with acceptable covalent geometry,structures with favorable non-bond energy,structures with the least restraint violations,structures with the lowest energy NMR Refine Method: SOLUTION NMR