NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.
DOI:10.2210/pdb1qwa/pdb   NDB ID: 1QWA
1QWA
Primary Citation
 
 
  •   Molecular Description Hide
    Classification: RNA
    Structure Weight: 6680.06
    Molecule: 18S ribosomal RNA, 5'ETS
    Polymer: 1 Type: rna Length: 21
    Chains: A
    Fragment: B2NRE
    Details: B2: a RNA hairpin derived from nts 394-410 of the mouse 5' ETS.
     

  •   Related Citations in PDB Entry (REMARK 1) Hide
     
  •   Source Hide
    Polymer: 1
    Scientific Name: Synthetic construct   Taxonomy    
     
  •   Related PDB Entries Hide
    Identifier Details
    1F7F   Solution structure and metal ion binding of the P4 element from bacterial RNase P RNA. Structure contains 5' bulged uridine in the context of a GC/CG stack. 
    1F7Y   Crystal structure of the cUUCGg tetraloop. 
    1JP0   Structure of the UGAGAU hexaloop that braces Bacillus RNase P for action. Strucutre contains a 5' bulged uridine in the context of a GC/GC stack. 
    1QWB   NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA haiprin containing the in vitro selected consensus sequence for nucleolin RBD12. 
     
  •   Structural Biology Knowledgebase Data Hide
     
  • Nucleic Acid Database Hide
    View the NDB ID associated with this structure:1QWA
     
 
Data in orange boxes are gathered from external resources (when available).
Structure Image
Downloadable viewers:
 
 
 
  •   MyPDB Personal Annotations Hide
     
  •   Deposition Summary Hide
    Authors:   Finger, L.D.,  Trantirek, L.,  Johansson, C.,  Feigon, J.

    Deposition:   2003-09-01
    Release:   2003-11-25
    Last Modified (REVDAT):   2012-02-01
     
  •   Revision History    Hide
    Mouse over text for details
    2012-02-01
    Other
    2011-07-13
    Version format compliance
     
  •   Experimental Details Hide
    Method:   SOLUTION NMR
    Exp. Data:
      NMR Restraints
    NMR Restraint Grid  
    NMR Ensemble
    Conformers Calculated:     17
    Conformers Submitted:     17
    Selection Criteria: all calculated structures submitted,back calculated data agree with experimental NOESY spectrum,structures with acceptable covalent geometry,structures with the least restraint violations,structures with the lowest energy
    NMR Refine
    Method: SOLUTION NMR