NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.     DOI:10.2210/pdb1qwa/pdb   NDB ID: 1QWA

1QWA Display Files close FASTA Sequence PDB File PDB File (Header) mmCIF File mmCIF File (Header) PDBML/XML File PDBML/XML File (Header) Download Files close FASTA Sequence PDB File (Text) PDB File (gz) mmCIF File mmCIF File (gz) PDBML/XML File PDBML/XML File (gz) NMR Restraints (Text) NMR Restraints (gz) Print this Page Share this Page close Email Delicious Stumble Google More... Link this Page

Primary Citation       Molecular Description Hide Classification: RNA Structure Weight: 6680.06   Molecule: 18S ribosomal RNA, 5'ETS Polymer: 1 Type: polyribonucleotide Length: 21 Chains: A Fragment: B2NRE Other Details: B2: a RNA hairpin derived from nts 394-410 of the mouse 5' ETS.       Source Hide Polymer: 1 Scientific Name: Synthetic construct         Related PDB Entries Hide Id Details 1F7F  Solution structure and metal ion binding of the P4 element from bacterial RNase P RNA. Structure contains 5' bulged uridine in the context of a GC/CG stack.  1F7Y  Crystal structure of the cUUCGg tetraloop.  1JP0  Structure of the UGAGAU hexaloop that braces Bacillus RNase P for action. Strucutre contains a 5' bulged uridine in the context of a GC/GC stack.  1QWB  NMR strucutre of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA haiprin containing the in vitro selected consensus sequence for nucleolin RBD12.      Reset Layout

Structure Image More Images... View in Jmol Other Viewers close KiNG WebMol FirstGlance Kiosk SimpleViewer Protein Workshop Ligand Explorer         Deposition Summary Hide Authors:   Finger, L.D.,   Trantirek, L.,   Johansson, C.,   Feigon, J. Deposition:   2003-09-01 Release:   2003-11-25 Last Modified (REVDAT):   2009-02-24       Experimental Details Hide Method:   SOLUTION NMR Experimental Data:    [ NMR Restraint Grid ] NMR Ensemble Conformers Calculated:     17 Conformers Submitted:     17 Selection Criteria: all calculated structures submitted,back calculated data agree with experimental NOESY spectrum,structures with acceptable covalent geometry,structures with the least restraint violations,structures with the lowest energy NMR Refine Method: SOLUTION NMR