NMR structure of 5'-r(GGAUGCCUCCCGAGUGCAUCC): an RNA hairpin derived from the mouse 5'ETS that binds nucleolin RBD12.

Experimental Data Snapshot

  • Method: SOLUTION NMR
  • Conformers Calculated: 17
  • Conformers Submitted: 17
  • Selection Criteria: All Calculated Structures Submitted Back Calculated Data Agree with Experimental Noesy Spectrum Structures with Acceptable Covalent Geometry Structures with the Least Restraint Violations Structures with the Lowest Energy


Sequence Display for 1QWA

Classification: RNA

Total Structure Weight: 6680.01

Macromolecule Entities
Molecule Chains Length Organism Details
18S ribosomal RNA, 5'ETS A 21 synthetic B2: a RNA hairpin derived from nts 394-410 of the mouse 5' ETS.

Experimental Data & Validation

Experimental Data

  • Method: SOLUTION NMR
  • Conformers Calculated: 17
  • Conformers Submitted: 17
  • Selection Criteria: all calculated structures submitted,back calculated data agree with experimental NOESY spectrum,structures with acceptable covalent geometry,structures with the least restraint violations,structures with the lowest energy

Structure Validation

View Full Validation Report or Ramachandran Plots

Entry History

Deposition Data

  • Deposited Date: 2003-09-01
  • Released Date: 2003-11-25
  • Deposition author(s): Finger, L.D., Trantirek, L., Johansson, C., Feigon, J.

Revision History

  • 2008-04-29
    Type: Version format compliance
  • 2011-07-13
    Type: Version format compliance
  • 2012-02-01
    Type: Other