X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution DOI:10.2210/pdb1kx3/pdb   NDB ID: PD0285

1KX3   Display Files  close FASTA Sequence PDB File PDB File (Header) mmCIF File mmCIF File (Header) PDBML/XML File PDBML/XML File (Header)   Download Files  close FASTA Sequence PDB File (Text) PDB File (gz) mmCIF File mmCIF File (gz) PDBML/XML File PDBML/XML File (gz) Biological Assembly (gz) (A)   Share this Page  close Facebook Twitter LinkedIn Email Link this Page

Primary Citation       Related Citations in PDB Entry (REMARK 1) Hide     Molecular Description Hide Classification: Structural Protein/dna Structure Weight: 199468.39 Molecule: DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') Polymer: 1 Type: dna Length: 146 Chains: I, J Details: palindromic 146 base pair DNA duplex Organism Homo sapiens Molecule: histone H3 Polymer: 2 Type: protein Length: 135 Chains: A, E Organism Xenopus laevis UniProtKB:   Protein Feature View | Search PDB | P84233     Molecule: histone H4 Polymer: 3 Type: protein Length: 102 Chains: B, F Organism Xenopus laevis UniProtKB:   Protein Feature View | Search PDB | P62799     Molecule: histone H2A.1 Polymer: 4 Type: protein Length: 128 Chains: C, G Organism Xenopus laevis UniProtKB:   Protein Feature View | Search PDB | P06897     Molecule: histone H2B.2 Polymer: 5 Type: protein Length: 125 Chains: D, H Organism Xenopus laevis UniProtKB:   Protein Feature View | Search PDB | P02281         Source Hide Polymer: 1 Scientific Name: Homo sapiens   Taxonomy   Common Name: Human Expression System: Escherichia coli   Polymer: 2 Scientific Name: Xenopus laevis   Taxonomy   Common Name: African clawed frog Expression System: Escherichia coli   Polymer: 3 Scientific Name: Xenopus laevis   Taxonomy   Common Name: African clawed frog Expression System: Escherichia coli   Polymer: 4 Scientific Name: Xenopus laevis   Taxonomy   Common Name: African clawed frog Expression System: Escherichia coli   Polymer: 5 Scientific Name: Xenopus laevis   Taxonomy   Common Name: African clawed frog Expression System: Escherichia coli       Related PDB Entries Hide Identifier Details 1AOI  NCP146 at 2.8 A  1KX4  NCP146b at 2.6 A  1KX5  NCP147 at 1.9 A      Ligand Chemical Component Hide Identifier Formula Name Interactions MN Search  Download  Mn MANGANESE (II) ION   Ligand Explorer     External Domain Annotations Hide SCOP Classification v1.75: 8 Domains - data from SCOP   CATH Classification v3.4.0: 8 Domains - data from CATH   Pfam Classification: 7 Domains - data from Pfam   GO Terms: 22 Terms - data from GO      Structural Biology Knowledgebase Data Hide   Nucleic Acid Database Hide View the NDB ID associated with this structure: PD0285     Data in orange boxes are gathered from external resources (when available). Reset Layout

Biological Assembly            View in 3D More Images... Biological assembly 1 assigned by authors Downloadable viewers: Simple Viewer Protein Workshop Ligand Explorer Kiosk Viewer Other Viewers  KiNG WebMol QuickPDB FirstGlance         MyPDB Personal Annotations Hide     Deposition Summary Hide Authors:   Davey, C.A.,  Sargent, D.F.,  Luger, K.,  Maeder, A.W.,  Richmond, T.J. Deposition:   2002-01-31 Release:   2002-12-25 Last Modified (REVDAT):   2009-02-24     Revision History    Hide Mouse over text for details 2011-07-13 Version format compliance     Experimental Details Hide Method:   X-RAY DIFFRACTION Exp. Data: N/A Resolution[Å]:   2.00 R-Value: 0.241 (obs.) R-Free: 0.275 Space Group: P 21 21 21 Unit Cell:   Length [Å] Angles [°] a = 105.40 α = 90.00  b = 181.54 β = 90.00  c = 109.60 γ = 90.00      Molecule of the Month Hide Nucleosome