POP-OUT | CLOSE
X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution
DOI:10.2210/pdb1kx3/pdb   NDB ID: PD0285
1KX3
Primary Citation
 
 
  •   Related Citations in PDB Entry (REMARK 1) Hide
     
  •   Molecular Description Hide
    Classification: Structural Protein/dna
    Structure Weight: 199468.39
    Molecule: DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3')
    Polymer: 1 Type: dna Length: 146
    Chains: I, J
    Details: palindromic 146 base pair DNA duplex
    Organism Homo sapiens
    Molecule: histone H3
    Polymer: 2 Type: protein Length: 135
    Chains: A, E
    Organism Xenopus laevis
    UniProtKB:   Protein Feature View | Search PDB | P84233  
    Molecule: histone H4
    Polymer: 3 Type: protein Length: 102
    Chains: B, F
    Organism Xenopus laevis
    UniProtKB:   Protein Feature View | Search PDB | P62799  
    Molecule: histone H2A.1
    Polymer: 4 Type: protein Length: 128
    Chains: C, G
    Organism Xenopus laevis
    UniProtKB:   Protein Feature View | Search PDB | P06897  
    Molecule: histone H2B.2
    Polymer: 5 Type: protein Length: 125
    Chains: D, H
    Organism Xenopus laevis
    UniProtKB:   Protein Feature View | Search PDB | P02281  
     
  •   Source Hide
    Polymer: 1
    Scientific Name: Homo sapiens   Taxonomy   Common Name: Human Expression System: Escherichia coli  
    Polymer: 2
    Scientific Name: Xenopus laevis   Taxonomy   Common Name: African clawed frog Expression System: Escherichia coli  
    Polymer: 3
    Scientific Name: Xenopus laevis   Taxonomy   Common Name: African clawed frog Expression System: Escherichia coli  
    Polymer: 4
    Scientific Name: Xenopus laevis   Taxonomy   Common Name: African clawed frog Expression System: Escherichia coli  
    Polymer: 5
    Scientific Name: Xenopus laevis   Taxonomy   Common Name: African clawed frog Expression System: Escherichia coli  
     
  •   Related PDB Entries Hide
    Identifier Details
    1AOI  NCP146 at 2.8 A 
    1KX4  NCP146b at 2.6 A 
    1KX5  NCP147 at 1.9 A 
     
  •   Ligand Chemical Component Hide
    Identifier Formula Name Interactions
    MN
    Search 
    Download 
    MN Mn
    MANGANESE (II) ION
     
  •   External Domain Annotations Hide
     
  •   Structural Biology Knowledgebase Data Hide
     
  • Nucleic Acid Database Hide
    View the NDB ID associated with this structure: PD0285
     
 
Data in orange boxes are gathered from external resources (when available).
 
 
  •   MyPDB Personal Annotations Hide
     
  •   Deposition Summary Hide
    Authors:   Davey, C.A.,  Sargent, D.F.,  Luger, K.,  Maeder, A.W.,  Richmond, T.J.

    Deposition:   2002-01-31
    Release:   2002-12-25
    Last Modified (REVDAT):   2009-02-24
     
  •   Revision History    Hide
    Mouse over text for details
    2011-07-13
    Version format compliance
     
  •   Experimental Details Hide
    Method:   X-RAY DIFFRACTION
    Exp. Data:
    N/A
    Resolution[Å]:   2.00
    R-Value: 0.241 (obs.)
    R-Free: 0.275
    Space Group: P 21 21 21
    Unit Cell:
      Length [Å] Angles [°]
    a = 105.40 α = 90.00 
    b = 181.54 β = 90.00 
    c = 109.60 γ = 90.00